Login to display prices
Login to display prices
TSPAN3-tetraspanin 3 Gene View larger

TSPAN3-tetraspanin 3 Gene

PTXBC000704

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN3-tetraspanin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN3-tetraspanin 3 Gene

Proteogenix catalog: PTXBC000704
Ncbi symbol: TSPAN3
Product name: TSPAN3-tetraspanin 3 Gene
Size: 2ug
Accessions: BC000704
Gene id: 10099
Gene description: tetraspanin 3
Synonyms: TM4-A; TM4SF8; TSPAN-3; tetraspanin-3; tetraspan 3; tetraspan TM4SF; tetraspanin TM4-A; transmembrane 4 superfamily member 8; tetraspanin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccagtgcggcatcacctcctccaagaccgtgctggtctttctcaacctcatcttctggggggcagctggcattttatgctatgtgggagcctatgtcttcatcacttatgatgactatgaccacttctttgaagatgtgtacacgctcatccctgctgtagtgatcatagctgtaggagccctgcttttcatcattgggctaattggctgctgtgccacaatccgggaaagtcgctgtggacttgcctttgtcatcatcctgctcttggtttttgtcacagaagttgttgtagtggttttgggatatgtttacagagcaaaggtggaaaatgaggttgatcgcagcattcagaaagtgtataagacctacaatggaaccaaccctgatgctgctagccgggctattgattatgtacagagacagctgcattgttgtggaattcacaactactcagactgggaaaatacagattggttcaaagaaaccaaaaaccagagtgtccctcttagctgctgcagagagactgccagcaattgtaatggcagcctggcccacccttccgacctctatgctgaggggtgtgaggctctagttgtgaagaagctacaagaaatcatgatgcatgtgatctgggccgcactggcatttgcagctattcagctgctgggcatgctgtgtgcttgcatcgtgttgtgcagaaggagtagagatcctgcttacgagctcctcatcactggcggaacctatgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: