RPP14-ribonuclease P/MRP 14kDa subunit Gene View larger

RPP14-ribonuclease P/MRP 14kDa subunit Gene

PTXBC012017

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPP14-ribonuclease P/MRP 14kDa subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPP14-ribonuclease P/MRP 14kDa subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012017
Product type: DNA & cDNA
Ncbi symbol: RPP14
Origin species: Human
Product name: RPP14-ribonuclease P/MRP 14kDa subunit Gene
Size: 2ug
Accessions: BC012017
Gene id: 11102
Gene description: ribonuclease P/MRP 14kDa subunit
Synonyms: HsHTD2; P14; ribonuclease P protein subunit p14; 3-hydroxyacyl-[acyl-carrier-protein] dehydratase; Hydroxyacyl-thioester dehydratase type 2, mitochondrial; ribonuclease P/MRP 14kDa subunit; ribonuclease P/MRP subunit p14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgcccctgctgccacatatgaaagagtagtttacaaaaacccttccgagtaccactacatgaaagtctgcctagaatttcaagattgtggagttggactgaatgctgcacagttcaaacagctgcttatttcggctgtgaaggacctgtttggggaggttgatgccgccttacctttggacatcctaacctatgaagagaagaccttgtcagccatcttgagaatatgtagcagtggtcttgtcaaattgtggagctctttgaccctgttaggatcctataaaggcaaaaaatgtgctttccgggtgattcaggtttctccatttcttcttgcattatctggtaatagtagggaactagtattggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cAMP responsive element modulator
- cornichon homolog 4 (Drosophila)
- ribonuclease, RNase A family, 4
- dual specificity phosphatase 23

Buy RPP14-ribonuclease P/MRP 14kDa subunit Gene now

Add to cart