Login to display prices
Login to display prices
RGR-retinal G protein coupled receptor Gene View larger

RGR-retinal G protein coupled receptor Gene

PTXBC008094

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGR-retinal G protein coupled receptor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGR-retinal G protein coupled receptor Gene

Proteogenix catalog: PTXBC008094
Ncbi symbol: RGR
Product name: RGR-retinal G protein coupled receptor Gene
Size: 2ug
Accessions: BC008094
Gene id: 5995
Gene description: retinal G protein coupled receptor
Synonyms: RGR-opsin; RP44; RPE-retinal G protein-coupled receptor; retinal G protein coupled receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagaccagtgccttgcccaccggcttcggggagctcgaggtgctggctgtggggatggtgctactggtggaagaccccggagctgcggactccctgccacctactggtgctgagcttggctcttgcggacagtgggatcagcctgaatgccctcgttgcagccacatccagccttctccgtgtctcccacaggcgctggccctacggctcggacggctgccaggctcacggcttccagggctttgtgacagcgttggccagcatctgcagcagtgcagccatcgcatgggggcgttatcaccactactgcacccgccaaaatgctgccatcggtctcatcattttgagtggcgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: