BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene View larger

BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000899
Product type: DNA & cDNA
Ncbi symbol: BET1
Origin species: Human
Product name: BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC000899
Gene id: 10282
Gene description: blocked early in transport 1 homolog (S. cerevisiae)
Synonyms: Bet1 golgi vesicular membrane trafficking protein; BET1 homolog; HBET1; Bet1p homolog; Golgi vesicular membrane trafficking protein p18; blocked early in transport 1 homolog; golgi vesicular membrane-trafficking protein p18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcgtgcaggcctgggtgaaggagtacctcctggcaactatgggaactatggctatgctaatagtgggtatagtgcctgtgaagaagaaaatgagaggctcactgaaagtctgagaagcaaagtaactgctataaaatctctttccattgaaataggccatgaagttaaaacccagaataaattattagctgaaatggattcacaatttgattccacaactggatttctaggtaaaactatgggcaaactgaagattttatccagagggagccaaacaaagctgctgtgctatatgatgctgttttctttatttgtcttttttatcatttattggattattaaactgaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vacuolar protein sorting 53 homolog (S. cerevisiae)
- non-metastatic cells 1, protein (NM23A) expressed in
- ARD1 homolog A, N-acetyltransferase (S. cerevisiae)
- glucose-fructose oxidoreductase domain containing 2

Buy BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene now

Add to cart