ZNF593-zinc finger protein 593 Gene View larger

ZNF593-zinc finger protein 593 Gene

PTXBC002580

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF593-zinc finger protein 593 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF593-zinc finger protein 593 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002580
Product type: DNA & cDNA
Ncbi symbol: ZNF593
Origin species: Human
Product name: ZNF593-zinc finger protein 593 Gene
Size: 2ug
Accessions: BC002580
Gene id: 51042
Gene description: zinc finger protein 593
Synonyms: ZT86; zinc finger protein 593; zinc finger protein T86
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcgaagcggcggcggccggacttggatgagattcaccgcgagctgcggcctcagggatccgcacgaccccagcccgacccaaacgccgagttcgaccccgacctgccagggggcggtctgcaccgctgtctggcctgcgcgaggtacttcatcgattccaccaacctgaagacccacttccgatccaaagaccacaagaaaaggctgaagcagctgagcgtcgagccctacagtcaggaagaggcggagagggcagcgggtatgggatcctatgtgccccccaggcggctggcagtgcccacggaagtgtccactgaggtccctgagatggatacctctacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NTF2-like export factor 1
- zinc finger protein 611
- zinc finger protein 580
- zinc finger protein 747

Buy ZNF593-zinc finger protein 593 Gene now

Add to cart