Login to display prices
Login to display prices
NXT1-NTF2-like export factor 1 Gene View larger

NXT1-NTF2-like export factor 1 Gene

PTXBC000759

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NXT1-NTF2-like export factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NXT1-NTF2-like export factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000759
Product type: DNA & cDNA
Ncbi symbol: NXT1
Origin species: Human
Product name: NXT1-NTF2-like export factor 1 Gene
Size: 2ug
Accessions: BC000759
Gene id: 29107
Gene description: NTF2-like export factor 1
Synonyms: MTR2; P15; NTF2-related export protein 1; NTF2-like export factor 1; NTX2-like export factor1; NUTF-like export factor 1; protein p15; nuclear transport factor 2 like export factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatctgtggatttcaagacctatgtggatcaggcctgcagagctgctgaggagtttgtcaatgtctactacaccaccatggataagcggcggcgtttgctgtcccgcctgtacatgggcacagccaccctggtctggaatggcaatgctgtttcaggacaagaatccttgagtgagttttttgaaatgttgccttccagcgagttccaaatcagcgtggtagactgccagcctgttcatgatgaagccacaccaagccagaccacggtccttgttgtcatctgtggatcagtgaagtttgaggggaacaaacaacgggacttcaaccagaacttcatcctgaccgcccaggcctcacccagcaacacagtgtggaagatcgcaagtgactgcttccgcttccaggactgggccagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 611
- zinc finger protein 580
- zinc finger protein 747
- zinc finger protein 581