FAM127B-family with sequence similarity 127, member B Gene View larger

FAM127B-family with sequence similarity 127, member B Gene

PTXBC000393

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM127B-family with sequence similarity 127, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM127B-family with sequence similarity 127, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000393
Product type: DNA & cDNA
Ncbi symbol: FAM127B
Origin species: Human
Product name: FAM127B-family with sequence similarity 127, member B Gene
Size: 2ug
Accessions: BC000393
Gene id: 26071
Gene description: family with sequence similarity 127, member B
Synonyms: protein FAM127B; CXX1b; MAR8A; mammalian retrotransposon derived protein 8A; family with sequence similarity 127 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggtcgggtgcagctgatgaaggccctcctggccgggcccctccggcccgcggcgcgtcgctggaggaacccgattccctttcccgagacgtttgacggagataccgaccgactcccggagttcatcgtgcagacgtgctcctacatgttcgtggacgagaacacgttctccaacgacgccctgaaggtgacgttcctcatcacccgcctcacggggccagccctgcagtgggtgatcccctacatcaggaaggagagccccctgctcaatgattaccggggcttcctggccgagatgaagcgggtctttggatgggaggaggacgaggacttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 104, member A
- family with sequence similarity 128, member A
- family with sequence similarity 107, member A
- growth arrest and DNA-damage-inducible, gamma

Buy FAM127B-family with sequence similarity 127, member B Gene now

Add to cart