Login to display prices
Login to display prices
FAM27E3-family with sequence similarity 27, member E3 Gene View larger

FAM27E3-family with sequence similarity 27, member E3 Gene

PTXBC032035

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM27E3-family with sequence similarity 27, member E3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM27E3-family with sequence similarity 27, member E3 Gene

Proteogenix catalog: PTXBC032035
Ncbi symbol: FAM27E3
Product name: FAM27E3-family with sequence similarity 27, member E3 Gene
Size: 2ug
Accessions: BC032035
Gene id: 100131997
Gene description: family with sequence similarity 27, member E3
Synonyms: family with sequence similarity 27, member E3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatatttcaattgctccgggaccgaagaatctcctcacgtgggccaggccttcacacacccaaagcggaaccgcgtcggcgaaaaggattgacaaccggtctcatgacccaggcagagaggcagaaacaggctcaccaaagacaggccgccatgcgagaaacagctttgtggtgcacagggcacattcggccaaggacacacacgcacacgggcacacacacacaaaccgacagagagagggaaagaaacacacagagactgagagacagagagagaagagagaatgggagacacacacacacatacacacacagacacacacacagagtcttatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: