CD79B-CD79b molecule, immunoglobulin-associated beta Gene View larger

CD79B-CD79b molecule, immunoglobulin-associated beta Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD79B-CD79b molecule, immunoglobulin-associated beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CD79B-CD79b molecule, immunoglobulin-associated beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030210
Product type: DNA & cDNA
Ncbi symbol: CD79B
Origin species: Human
Product name: CD79B-CD79b molecule, immunoglobulin-associated beta Gene
Size: 2ug
Accessions: BC030210
Gene id: 974
Gene description: CD79b molecule, immunoglobulin-associated beta
Synonyms: CD79b molecule; CD79b molecule, immunoglobulin-associated beta; CD79b antigen (immunoglobulin-associated beta); AGM6; B29; IGB; B-cell antigen receptor complex-associated protein beta chain; B-cell-specific glycoprotein B29; Ig-beta; immunoglobulin-associated B29 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaggctggcgttgtctcctgtgcccagccactggatggtggcgttgctgctgctgctctcaggtacagaacccacgacgaggcctgtggggtttgctctcatctccagctgtctgggccctgcggctctgcctcctgcttgctccaccctcctcctctgtctctcactctttaccgcctgtctccctctcatggccctggggcctgggtctgtgggtgtcagctgcacgtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trafficking protein particle complex 2-like
- fucosyltransferase 2 (secretor status included)
- DnaJ (Hsp40) homolog, subfamily C, member 12
- DiGeorge syndrome critical region gene 6-like

Buy CD79B-CD79b molecule, immunoglobulin-associated beta Gene now

Add to cart