DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene View larger

DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034713
Product type: DNA & cDNA
Ncbi symbol: DNAJC10
Origin species: Human
Product name: DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene
Size: 2ug
Accessions: BC034713
Gene id: 54431
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 10
Synonyms: ERdj5; JPDI; MTHr; PDIA19; dnaJ homolog subfamily C member 10; DnaJ (Hsp40) homolog, subfamily C, member 10; ER-resident protein ERdj5; J-domain-containing protein disulfide isomerase-like protein; endoplasmic reticulum DNA J domain-containing protein 5; macrothioredoxin; protein disulfide isomerase family A, member 19; DnaJ heat shock protein family (Hsp40) member C10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattaaaggaaaagtgaaagctggaaaagtagactgtcaggcttatgctcagacatgccagaaagctgggatcagggcctatccaactgttaagttttatttctacgaaagagcaaagagaaattttcaagaagagcagataaataccagagatgcaaaagcaatcgctgccttaataagtgaaaaattggaaactctccgaaatcaaggcaagaggaataaggatgaactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD79b molecule, immunoglobulin-associated beta
- trafficking protein particle complex 2-like
- fucosyltransferase 2 (secretor status included)
- DnaJ (Hsp40) homolog, subfamily C, member 12

Buy DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene now

Add to cart