Login to display prices
Login to display prices
TTC16-tetratricopeptide repeat domain 16 Gene View larger

TTC16-tetratricopeptide repeat domain 16 Gene

PTXBC031281

New product

Data sheet of TTC16-tetratricopeptide repeat domain 16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTC16-tetratricopeptide repeat domain 16 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC031281
Product type: DNA & cDNA
Ncbi symbol: TTC16
Origin species: Human
Product name: TTC16-tetratricopeptide repeat domain 16 Gene
Size: 2ug
Accessions: BC031281
Gene id: 158248
Gene description: tetratricopeptide repeat domain 16
Synonyms: tetratricopeptide repeat protein 16; TPR repeat protein 16; tetratricopeptide repeat domain 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagattcggacgaggatgccctgaaggttgaccagggcccctcacgggacatcccaaagccatgggtgattccagcccccaaagggatcctgcagcacatctttgggaccagccacgtgttccaaagcatctgtgatgtaaaaccaaaggtcacagggttaacagtgcccctcaaagtcagggaatactactccagaggccagcagtgcttggagcaggcagactgggagacagctgtgctgctcttctcccgcgcactccacctggacccacagctggtggacttctatgccttacgggctgaggcctacctccagctctgtgacttctcctcggccgcccagaacctgcgaagggcctactcattacagcaggacaactgcaagcacctggagcgcctcacctttgtgctctacctacagggacaatgcctttttgagcagtgtgccttcctggatgccctgaatgtcttctcacatgctgctgagctccagcctgagaaaccatgcttccgttaccgatgcatggcctgtctcctggccctcaagcagcatcaggcctgcctcacgctcatcaccaacgagctgaagcaggacaccaccaacgccgatgtctacatcttccgggccagactctacaactttctccagaagccccacctctgctaccgggacctgcacagcgccttgctgttgaatcccaagcacccgcaggccaggatgctgctccagaagatggtggcccaggcccagcaggcgcgccaagatgcggggatcctggctgtgcagggcaagctgcagcacgcactgcagcggatcaaccgtgccatcgagaacaaccctctggaccccagtctcttcctcttccggggcaccatgtaccgacggctccaggagttcgatggggcagtggaggacttcctgaaggtgctggacatggtgaccgaggaccaggaggacatggtgcggcaggcacagcgccagctgttgctgacctacaacgactttgccgtgcactgctacaggcagggcgcctaccaggagggcgtgctgctgctgaacaaggccctccgggacgagcagcaggagaaaggactctacatcaaccgaggcgattgcttcttccagctgggcaacctggcctttgccgaggcggactaccagcaggcgctggcgctgagtcctcaggacgagggcgccaacacgcgcacgggcctgctgcaggagaagatgggcttctgcgagcagaggcgcaagcagttccagaaggcagagaaccacttctccacggccatccggcacaacccccagaaggcccagtactacctgtaccgggccaagagccggcagctgctgcagaacatttttggggcccgccaggatgtggccactgtcctgctcctcaaccccaagcaaccaaagctgtccctgctgatgaccaacctcttcccgggcatgtcggtggaggaggtgcttagcacccagatagcccacctggccaggctgcagctggagcagatggtggagggcagcctgcaggccggcagcccacaaggcattgtggggatgcttaagcggcacgagttggagcgccagaaggccttggccctgcagcactcatggaagcagggggagcctttgattgcgacctccgaggagctgaaggccacccctgagattccgcaggtaaaaccgggaagctcagagggagaggctgaggcccctgaggaggaggaagaaaaggagaaggagaaaaaaggggagaaaaaatcagagctcatacctagcaaggtggcgtccctgtctgacagctaccttgaccagacctcttcagcctccagcatgagcttcaggaccacaggcacctcagagactgagatgtcggctatctgccaggaatacaggagcacctcagccaccgccgtgacattctctgactcgtcactgttgaagacgcaatcctcggactctgggaacaacagggaggcactaagccatggtcccagaaaaatcaaggccacccagggccagaggcagagccttagcaagactgagcccacccagagccagaggcggaactccagcaagaccaaggccactatacacaagaggaactccagcaagaccaaggccacccaaagccagaggcggaactccagcaagaccagggccacccagggccaggggcagagctccagcaagactgaggccactcagggccagaggcagagctccagcgagattgaggccacccagggcccaaggcaggagcccagcaagaccaagaccacccggagcccaaggcagaggcccagaaaggtcaaggctgctcgtggccggagctggagacccagcaaggttgatgccacccagggccgaagcaggggactgctccgaagttccaccaagactgaggctttctatgactcaaactggagcctcagcaagactgagtatgcccaaggccagggccagaggtccagcaaggctgagggtgcccagggcaagagccagggcatgagctcaacttccagcaaggccgagtccacctggggacccagcccaagtctcagcaaaactgaggttgatcaggacctcacctactatgaatctgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prion protein interacting protein
- chromatin accessibility complex 1
- cysteine-rich hydrophobic domain 2
- caveolin 1, caveolae protein, 22kDa