Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PRNPIP-prion protein interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRNPIP-prion protein interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001072 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRNPIP |
| Origin species: | Human |
| Product name: | PRNPIP-prion protein interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC001072 |
| Gene id: | 79033 |
| Gene description: | prion protein interacting protein |
| Synonyms: | PRNPIP; PINT1; ERI1 exoribonuclease 3; enhanced RNAi three prime mRNA exonuclease homolog 3; prion interactor 1; prion protein-interacting protein; ERI1 exoribonuclease family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggatggtcagccaagcctgcagcaagtgctggagagggtcgatgaatggatggcgaaggaaggcctcttagatccaaacgtcaagtcaatttttgtcacctgtggagactgggacttaaaagtcatgctcccaggccagtgccagtacttgggcttgccagtggcggattacttcaagcagtggattaatctgaaaaaggcttacagcttcgccatgggctgctggcccaagaatggacttctagacatgaacaagggcctcagcctgcaacacataggccggccccacagcggcattgacgactgcaagaacattgccaacatcatgaagacactcgcctatcgaggcttcatcttcaagcagacatcgaagccgttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromatin accessibility complex 1 - cysteine-rich hydrophobic domain 2 - caveolin 1, caveolae protein, 22kDa - GC-rich promoter binding protein 1 |