TSPAN8-tetraspanin 8 Gene View larger

TSPAN8-tetraspanin 8 Gene

PTXBC005246

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN8-tetraspanin 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN8-tetraspanin 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005246
Product type: DNA & cDNA
Ncbi symbol: TSPAN8
Origin species: Human
Product name: TSPAN8-tetraspanin 8 Gene
Size: 2ug
Accessions: BC005246
Gene id: 7103
Gene description: tetraspanin 8
Synonyms: CO-029; TM4SF3; tetraspanin-8; transmembrane 4 superfamily member 3; tspan-8; tumor-associated antigen CO-029; tetraspanin 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggtgtgagtgcctgtataaaatattctatgtttaccttcaacttcttgttctggctatgtggtatcttgatcctagcattagcaatatgggtacgaataagcaatgactctcaagcaatttttggttctgaagatgtaggctctagctcctacgttgctgtggacatattgattgctgtaggtgccatcatcatgattctgggcttcctggcatgctgcggtgctataaaagaaagtcgctgcatgcttctgttgtttttcataggcttgcttctgatcctgctcctgcaggtggcgacaggtatcctaggagctgttttcaaatctaagtctgatcgcattgtgaatgaaactctctatgaaaacacaaagcttttgagcgccacaggggaaagtgaaaaacaattccaggaagccataattgtgtttcaagaagagtttaaatgctgcggtttggtcaatggagctgctgattggggaaataattttcaacactatcctgaattatgtgcctgtctagataagcagagaccatgccaaagctataatggaaaacaagtttacaaagagacctgtatttctttcataaaagacttcttggcaaaaaatttgattatagttattggaatagcatttggactggcagttattgagatactgggtttggtgttttctatggtcctgtattgccagatcgggaacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 4
- tetraspanin 1
- Src-like-adaptor
- actin, gamma 1

Buy TSPAN8-tetraspanin 8 Gene now

Add to cart