TSPAN4-tetraspanin 4 Gene View larger

TSPAN4-tetraspanin 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN4-tetraspanin 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN4-tetraspanin 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000389
Product type: DNA & cDNA
Ncbi symbol: TSPAN4
Origin species: Human
Product name: TSPAN4-tetraspanin 4 Gene
Size: 2ug
Accessions: BC000389
Gene id: 7106
Gene description: tetraspanin 4
Synonyms: NAG-2; NAG2; TETRASPAN; TM4SF7; TSPAN-4; tetraspanin-4; novel antigen 2; tetraspan TM4SF; transmembrane 4 superfamily member 7; tetraspanin 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcgcgcctgcctccaggccgtcaagtacctcatgttcgccttcaacctgctcttctggctgggaggctgtggcgtgctgggtgtcggcatctggctggccgccacacaggggagcttcgccacgctgtcctcttccttcccgtccctgtcggctgccaacctgctcatcatcaccggcgcctttgtcatggccatcggcttcgtgggctgcctgggtgccatcaaggagaacaagtgcctcctgctcactttcttcctgctgctgctgctggtgttcctgctggaggccaccatcgccatcctcttcttcgcctacacggacaagattgacaggtatgcccagcaagacctgaagaaaggcttgcacctgtacggcacgcagggcaacgtgggcctcaccaacgcctggagcatcatccagaccgacttccgctgctgtggcgtctccaactacactgactggttcgaggtgtacaacgccacgcgggtacctgactcctgctgcttggagttcagtgagagctgtgggctgcacgcccccggcacctggtggaaggcgccgtgctacgagacggtgaaggtgtggcttcaggagaacctgctggctgtgggcatctttgggctgtgcacggcgctggtgcagatcctgggcctgaccttcgccatgaccatgtactgccaagtggtcaaggcagacacctactgcgcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 1
- Src-like-adaptor
- actin, gamma 1
- sorting nexin 4

Buy TSPAN4-tetraspanin 4 Gene now

Add to cart