IGK@-immunoglobulin kappa locus Gene View larger

IGK@-immunoglobulin kappa locus Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGK@-immunoglobulin kappa locus Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IGK@-immunoglobulin kappa locus Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016380
Product type: DNA & cDNA
Ncbi symbol: IGK@
Origin species: Human
Product name: IGK@-immunoglobulin kappa locus Gene
Size: 2ug
Accessions: BC016380
Gene id: 50802
Gene description: immunoglobulin kappa locus
Synonyms: IGK@; immunoglobulin kappa locus
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaccccagcgcagcttctcttcctcctgctactctggctcccaggtaccaccggagaaattgtgttgacgcagtctccagccaccctttctttgtctccaggggagagagccaccctctcctgcagggccagtcagattgttagtagcgcctacttagcctggtatcagcagaaacctggccaggctcccagactcctcatgtttggttcatccagcagggccactggcatcccagacaggttcagtggcagtgggtctgggacagacttcactctcaccatcagcagactggagcctgaagattttgcagtctattactgtcagcagtatggtagttcacagggcactttcggccctgggaccaaagtggatatcaaacgaactgtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaggacagcaaggacagcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin folding cofactor B
- transmembrane protein 51
- glutamate dehydrogenase 2
- mannose phosphate isomerase

Buy IGK@-immunoglobulin kappa locus Gene now

Add to cart