Login to display prices
Login to display prices
GLUD2-glutamate dehydrogenase 2 Gene View larger

GLUD2-glutamate dehydrogenase 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLUD2-glutamate dehydrogenase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GLUD2-glutamate dehydrogenase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005111
Product type: DNA & cDNA
Ncbi symbol: GLUD2
Origin species: Human
Product name: GLUD2-glutamate dehydrogenase 2 Gene
Size: 2ug
Accessions: BC005111
Gene id: 2747
Gene description: glutamate dehydrogenase 2
Synonyms: GDH2; GLUDP1; glutamate dehydrogenase 2, mitochondrial; GDH 2; glutamate dehydrogenase pseudogene 1; testicular secretory protein Li 14; glutamate dehydrogenase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaccagggtttagagataaaacatttgttgttcagggatttggtaatgtgggcctacactctatgagatatttacatcgttttggtgctaaatgtattgctgttggtgagtctgatgggagtatatggaatccagatggtattgacccaaaggaactggaagacttcaaattgcaacatgggtccattctgggcttccccaaggcaaagccctatgaaggaagcatcttggaggtcgactgtgacatactgatcccagctgccactgagaagcagttgaccaaatccaacgcacccagagtcaaagccaagatcattgctgaaggtgccaatgggccaacaactccagaagctgataagatcttcctggagagaaacattttggttattccagatctctacttgaatgctggaggagtgacagtatcttactttgagtggctgaagaatctaaatcatgtcagctatggccgtttgaccttcaaatatgaaagggattctaactaccacttgctcctgtctgttcaagagagtttagaaagaaaatttggaaagcatggtggaactattcccattgtacccacggcagagttccaagacagtatatcgggtgcatctgagaaagacattgtgcactctgccttggcatacacaatggagcgttctgccaggcaaattatgcacacagccatgaagtataacctgggattggacctgagaacagctgcctatgtcaatgccattgaaaaagtcttcaaagtgtacagtgaagctggtgtgaccttcacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mannose phosphate isomerase
- DAZ associated protein 1
- protoporphyrinogen oxidase
- cystathionine-beta-synthase