TBCB-tubulin folding cofactor B Gene View larger

TBCB-tubulin folding cofactor B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBCB-tubulin folding cofactor B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TBCB-tubulin folding cofactor B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005969
Product type: DNA & cDNA
Ncbi symbol: TBCB
Origin species: Human
Product name: TBCB-tubulin folding cofactor B Gene
Size: 2ug
Accessions: BC005969
Gene id: 1155
Gene description: tubulin folding cofactor B
Synonyms: CG22; CKAP1; CKAPI; tubulin-folding cofactor B; cytoskeleton associated protein 1; cytoskeleton-associated protein CKAPI; tubulin-specific chaperone B; tubulin folding cofactor B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtgacgggggtgtcggcacccacggtgaccgttttcatcagcagctccctcaacaccttccgctccgagaagcgatacagccgcagcctcaccatcgctgagttcaagtgtaaactggagttgctggtgggcagccctgcttcctgcatggaactggagctgtatggagttgacgacaagttctacagcaagctggatcaagaggatgcgctcctgggctcctaccctgtagatgacggctgccgcatccacgtcattgaccacagtggcgcccgccttggtgagtatgaggacgtgtcccgggtggagaagtacacgatctcacaagaagcctacgaccagaggcaagacacggtccgctctttcctgaagcgcagcaagctcggccggtacaacgaggaggagcgggctcagcaggaggccgaggccgcccagcgcctggccgaggagaaggcccaggccagctccatccccgtgggcagccgctgtgaggtgcgggcggcgggacaatcccctcgccggggcaccgtcatgtatgtaggtctcacagatttcaagcctggctactggattggtgtccgctatgatgagccactggggaaaaatgatggcagtgtgaatgggaaacgctacttcgaatgccaggccaagtatggcgcctttgtcaagccagcagtcgtgacggtgggggacttcccggaggaggactacgggttggacgagatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 51
- glutamate dehydrogenase 2
- mannose phosphate isomerase
- DAZ associated protein 1

Buy TBCB-tubulin folding cofactor B Gene now

Add to cart