TMEM51-transmembrane protein 51 Gene View larger

TMEM51-transmembrane protein 51 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM51-transmembrane protein 51 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM51-transmembrane protein 51 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000202
Product type: DNA & cDNA
Ncbi symbol: TMEM51
Origin species: Human
Product name: TMEM51-transmembrane protein 51 Gene
Size: 2ug
Accessions: BC000202
Gene id: 55092
Gene description: transmembrane protein 51
Synonyms: C1orf72; transmembrane protein 51
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggcccagtccaaggccaatggctcgcactatgcgctgaccgccatcggcctggggatgctggtccttggggtgatcatggccatgtggaacctggtacccggcttcagcgcggccgagaagccaacagctcagggcagcaacaagaccgaggtgggtggcggcatcctcaagagcaagaccttctctgtggcctacgtgctggtcggggccggggtgatgctgctgctgctttctatctgcctgagtatcagggataagaggaagcagcggcagggcgaggacctggcccatgtccagcacccgacaggcgctgggcctcacgcccaggaggaagacagccaggaggaagaagaggaggatgaggaggctgcctcaaggtactatgttcccagctacgaggaagtgatgaacacaaactactcagaagcaaggggagaggagcagaacccgaggttgagcatctctctcccgtcctatgagtcactgacggggctcgacgagaccacccccacatccaccagggctgacgtggaggccagccctgggaacccccctgacaggcagaactctaagttggccaaacgactgaaaccgctgaaagttcgaaggattaaatctgaaaagcttcacctcaaagactttaggatcaacctcccagacaaaaacgtccctcctccctcgatagagcctttgactcctccaccgcagtatgatgaagtccaggagaaggcccccgacacccggccgcccgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutamate dehydrogenase 2
- mannose phosphate isomerase
- DAZ associated protein 1
- protoporphyrinogen oxidase

Buy TMEM51-transmembrane protein 51 Gene now

Add to cart