MED7-mediator complex subunit 7 Gene View larger

MED7-mediator complex subunit 7 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MED7-mediator complex subunit 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MED7-mediator complex subunit 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005250
Product type: DNA & cDNA
Ncbi symbol: MED7
Origin species: Human
Product name: MED7-mediator complex subunit 7 Gene
Size: 2ug
Accessions: BC005250
Gene id: 9443
Gene description: mediator complex subunit 7
Synonyms: ARC34; CRSP33; CRSP9; mediator of RNA polymerase II transcription subunit 7; CRSP complex subunit 9; RNA polymerase transcriptional regulation mediator subunit 7 homolog; activator-recruited cofactor 34 kDa component; cofactor required for Sp1 transcriptional activation subunit 9; cofactor required for Sp1 transcriptional activation, subunit 9 (33kD); cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa; transcriptional coactivator CRSP33; mediator complex subunit 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgaaccacagcaagtgagtgcacttccaccacctccaatgcaatatatcaaggaatatacggatgaaaatattcaagaaggcttagctcccaagcctccccctccaataaaagacagttacatgatgtttggcaatcagttccaatgtgatgatcttatcatccgccctttggaaagtcagggcatcgaacggcttcatcctatgcagtttgatcacaagaaagaactgagaaaacttaatatgtctatccttattaatttcttggaccttttagatattttaataaggagccctgggagtataaaacgagaagagaaactagaagatcttaagctgctttttgtacacgtgcatcatcttataaatgaataccgaccccaccaagcaagagagaccttgagagtcatgatggaggtccagaaacgtcaacggcttgaaacagctgagagatttcaaaagcacctggaacgagtaattgaaatgattcagaattgcttggcttctttgcctgatgatttgcctcattcagaagcaggaatgagagtaaaaactgaaccaatggatgctgatgatagcaacaattgtactggacagaatgaacatcaaagagaaaattcaggtcataggagagatcagattatagagaaagatgctgccttgtgtgtcctaattgatgagatgaatgaaagaccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thymidine kinase 1, soluble
- immunoglobulin kappa locus
- tubulin folding cofactor B
- transmembrane protein 51

Buy MED7-mediator complex subunit 7 Gene now

Add to cart