DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene View larger

DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene

PTXBC005362

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005362
Product type: DNA & cDNA
Ncbi symbol: DIRAS3
Origin species: Human
Product name: DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene
Size: 2ug
Accessions: BC005362
Gene id: 9077
Gene description: DIRAS family, GTP-binding RAS-like 3
Synonyms: NOEY2; GTP-binding protein Di-Ras3; DIRAS family, GTP-binding RAS-like 3; distinct subgroup of the Ras family member 3; ras homolog gene family, member I; rho-related GTP-binding protein RhoI; DIRAS family GTPase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtaacgccagctttggctccaaggaacagaagctgctgaagcggttgcggcttctgcccgccctgcttatcctccgcgccttcaagccccacaggaagatcagagattaccgcgtcgtggtagtcggcaccgctggtgtggggaaaagtacgctgctgcacaagtgggcgagcggcaacttccgtcatgagtacctgccgaccattgaaaatacctactgccagttgctgggctgcagccacggtgtgctttccctgcacatcaccgacagcaagagtggcgacggcaaccgcgctctgcagcgccacgttatagcccggggccacgccttcgtcctggtctactcagtcaccaagaaggaaaccctggaagagctgaaggccttctatgagctgatctgcaagatcaaaggtaacaacctgcataagttccccatcgtgctggtgggcaataaaagtgatgacacccaccgggaggtggccctgaatgatggtgccacctgtgcgatggagtggaattgcgccttcatggagatttcagccaagaccgatgtgaatgtgcaggagctgttccacatgctgctgaattacaagaaaaagcccaccaccggcctccaggagcccgagaagaaatcccagatgcccaacaccactgagaagctgcttgacaagtgcataatcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxyacylglutathione hydrolase-like
- NOL1/NOP2/Sun domain family, member 4
- wings apart-like homolog (Drosophila)
- NOL1/NOP2/Sun domain family, member 2

Buy DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene now

Add to cart