Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005362 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DIRAS3 |
| Origin species: | Human |
| Product name: | DIRAS3-DIRAS family, GTP-binding RAS-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC005362 |
| Gene id: | 9077 |
| Gene description: | DIRAS family, GTP-binding RAS-like 3 |
| Synonyms: | NOEY2; GTP-binding protein Di-Ras3; DIRAS family, GTP-binding RAS-like 3; distinct subgroup of the Ras family member 3; ras homolog gene family, member I; rho-related GTP-binding protein RhoI; DIRAS family GTPase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtaacgccagctttggctccaaggaacagaagctgctgaagcggttgcggcttctgcccgccctgcttatcctccgcgccttcaagccccacaggaagatcagagattaccgcgtcgtggtagtcggcaccgctggtgtggggaaaagtacgctgctgcacaagtgggcgagcggcaacttccgtcatgagtacctgccgaccattgaaaatacctactgccagttgctgggctgcagccacggtgtgctttccctgcacatcaccgacagcaagagtggcgacggcaaccgcgctctgcagcgccacgttatagcccggggccacgccttcgtcctggtctactcagtcaccaagaaggaaaccctggaagagctgaaggccttctatgagctgatctgcaagatcaaaggtaacaacctgcataagttccccatcgtgctggtgggcaataaaagtgatgacacccaccgggaggtggccctgaatgatggtgccacctgtgcgatggagtggaattgcgccttcatggagatttcagccaagaccgatgtgaatgtgcaggagctgttccacatgctgctgaattacaagaaaaagcccaccaccggcctccaggagcccgagaagaaatcccagatgcccaacaccactgagaagctgcttgacaagtgcataatcatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hydroxyacylglutathione hydrolase-like - NOL1/NOP2/Sun domain family, member 4 - wings apart-like homolog (Drosophila) - NOL1/NOP2/Sun domain family, member 2 |