NSUN2-NOL1/NOP2/Sun domain family, member 2 Gene View larger

NSUN2-NOL1/NOP2/Sun domain family, member 2 Gene


New product

Data sheet of NSUN2-NOL1/NOP2/Sun domain family, member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSUN2-NOL1/NOP2/Sun domain family, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001041
Product type: DNA & cDNA
Ncbi symbol: NSUN2
Origin species: Human
Product name: NSUN2-NOL1/NOP2/Sun domain family, member 2 Gene
Size: 2ug
Accessions: BC001041
Gene id: 54888
Gene description: NOL1/NOP2/Sun domain family, member 2
Synonyms: tRNA (cytosine-5-)-methyltransferase NSUN2; MISU; MRT5; SAKI; TRM4; tRNA (cytosine(34)-C(5))-methyltransferase; 5-methycytoisine methyltransferase; Myc-induced SUN-domain-containing protein; NOL1/NOP2/Sun domain family, member 2; NOP2/Sun domain family, member 2; myc-induced SUN domain-containing protein; substrate of AIM1/Aurora kinase B; tRNA methyltransferase 4 homolog; NOP2/Sun RNA methyltransferase family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgtcccctttccagagggatttgttattgcgaatgatgtggacaacaagcgctgctacctgctcgtccatcaagccaagaggctgagcagcccctgcatcatggtggtcaaccatgatgcctccagcatacccaggctccagatagatgtggacggcaggaaagagatcctcttctatgatcgaattttatgtgatgtcccttgcagtggagacggcactatgagaaaaaacattgatgtttggaaaaagtggaccaccttaaatagcttgcagctacatggcttacagctgcggattgcaacacgcggggctgaacagctggctgaaggtggaaggatggtgtattccacgtgttcactaaaccctattgaggatgaagcagtcatagcatctttactggaaaaaagtgaaggtgctttggagcttgctgatgtgtctaatgaactgccagggctgaagtggatgcctggaatcacacagtggaaggtaatgacgaaagatgggcagtggtttacagactgggacgctgttcctcacagcagacacacccagatccgacctaccatgttccctccgaaggacccagaaaagctgcaggccatgcacctggagcgatgccttaggatattaccccatcatcagaatactggagggttttttgtggcagtattggtgaaaaaatcttcaatgccgtggaataaacgtcagccaaagcttcagggtaaatctgcagagaccagagaaagcacacagctgagccctgcagatctcacagaagggaaacccacagatccctctaagctggaaagtccgtcattcacaggaactggtgacacagaaatagctcatgcaactgaggatttagagaataatggcagtaagaaagatggcgtgtgtggtcctcctccatcaaagaaaatgaagttatttggatttaaagaagatccatttgtatttattcctgaagatgacccattatttccacctattgagaaattttatgctttggatccttcattcccaaggatgaatttgttaactcggactacagaagggaagaaaaggcagctctacatggtttctaaggagttgcggaatgtgctgctgaataacagtgagaagatgaaggttattaacacggggatcaaagtctggtgtagaaataacagcggtgaagagtttgactgtgctttccggctggcacaggagggaatatatacattgtatccatttattaactcaagaattattactgtatcaatggaagatgttaagatactgttgacccaggaaaatcccttttttagaaaactcagcagtgagacctacagtcaagcaaaggacctggcaaagggaagcatcgtgctgaagtatgaaccagattctgcgaatccagacgctctgcagtgtcccatcgtcttatgcggatggcggggaaaggcctccattcgaacttttgtgcccaagaatgaacggcttcattatctcaggatgatggggctggaggtattgggagaaaagaagaaggaaggggttatcctcacaaatgagagtgcagccagcaccggacagccagacaatgacgtgactgagggacagagagcaggagagcccaacagcccagatgcagaagaggccaacagtccagacgtgacagcaggctgtgacccggcgggggtccatccaccccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane 7 superfamily member 3
- collapsin response mediator protein 1
- eukaryotic elongation factor-2 kinase
- SRY (sex determining region Y)-box 30