NSUN4-NOL1/NOP2/Sun domain family, member 4 Gene View larger

NSUN4-NOL1/NOP2/Sun domain family, member 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSUN4-NOL1/NOP2/Sun domain family, member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSUN4-NOL1/NOP2/Sun domain family, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014441
Product type: DNA & cDNA
Ncbi symbol: NSUN4
Origin species: Human
Product name: NSUN4-NOL1/NOP2/Sun domain family, member 4 Gene
Size: 2ug
Accessions: BC014441
Gene id: 387338
Gene description: NOL1/NOP2/Sun domain family, member 4
Synonyms: 5-methylcytosine rRNA methyltransferase NSUN4; SHTAP; NOL1/NOP2/Sun domain family member 4; NOP2/Sun domain family, member 4; sperm head and tail associated protein; NOP2/Sun RNA methyltransferase family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgctgacactgaggggtgtccgggagctgctgaagcgtgtggacctcgcgacggtcccgcggagacatcgatataagaagaaatgggctgccacagagcccaaattccctgctgttcgactggctttgcagaattttgacatggcttacagtgtgcagtttggagatctttggccatcaatccgtgtcagtctcctctcagagcagaagtatggtgcactggtcaataactttgctgcctgggatcatgtaagtgctaagctggagcagctgagtgccaaggattttgtgaatgaagccatctcccactgggaactgcagtctgagggtggccaatctgcagccccatcccctgcctcctgggcctgcagtccgaaccttcgatgcttcacttttgacagaggggatatcagtcgcttccctcctgccagacctggcagcctgggtgtcatggagtactacctgatggatgctgcctccttgctgcctgttctggccctcggcctgcagcctggggacatcgtgcttgacctatgtgcagctcctgggggaaagacactagcgttgcttcagactggctgttgccgcaatcttgctgccaatgatctctccccgtcccgaatagccagactacagaagatccttcacagctatgtgcctgaagagatcagggatggaaatcaagttcgagttacctcatgggatggcaggaaatggggagaactggagggggacacctatgaccgggtgctggtggatgtgccctgtaccacagaccgccactcccttcatgaggaggagaacaacatctttaagcggtcaaggaagaaggagcgacagatattgcctgtgctgcaagtgcagcttcttgcggctggactccttgccaccaaaccaggaggccatgttgtctattctacctgctcactctcacacttacagaacgagtatgtggtgcaaggtgccattgagctcctggccaatcaatacagcatccaggtacaggtggaagatctgactcacttccgaagggttttcatggacacattttgtttcttctcatcctgtcaggttggggagctggtaataccaaacctcatggccaattttggccccatgtacttctgcaaaatgcgtaggctgacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - wings apart-like homolog (Drosophila)
- NOL1/NOP2/Sun domain family, member 2
- transmembrane 7 superfamily member 3
- collapsin response mediator protein 1

Buy NSUN4-NOL1/NOP2/Sun domain family, member 4 Gene now

Add to cart