Login to display prices
Login to display prices
HAGHL-hydroxyacylglutathione hydrolase-like Gene View larger

HAGHL-hydroxyacylglutathione hydrolase-like Gene

PTXBC004353

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAGHL-hydroxyacylglutathione hydrolase-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HAGHL-hydroxyacylglutathione hydrolase-like Gene

Proteogenix catalog: PTXBC004353
Ncbi symbol: HAGHL
Product name: HAGHL-hydroxyacylglutathione hydrolase-like Gene
Size: 2ug
Accessions: BC004353
Gene id: 84264
Gene description: hydroxyacylglutathione hydrolase-like
Synonyms: hydroxyacylglutathione hydrolase-like protein; GLO2-like/ RJD12; hydroxyacylglutathione hydrolase-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggtcaaggtcatccccgtgctcgaggacaactacatgtacctggtcatcgaggagctcacgcgcgaggcggtggccgtggacgtggctgtgcccaagaggctgctggagatcgtgggccgggagggggtgtctctgaccgctgtgctgaccacccaccatcactgggaccacgcgcggggaaacccggagctggcgcggcttcgtcccgggctggcggtgctgggcgcggacgagcgcatcttctcgctgacgcgcaggctggcgcacggcgaggagctgcggttcggggccatccacgtgcgttgcctcctgacgcccggccacaccgccggccacatgagctacttcctgtgggaggacgattgcccggacccacccgccctgttctcgggcgacgcgctgtcggtggccggctgcggctcgtgcctggagggcagcgcccagcagatgtaccagagcctggccgagctgggtaccctgccccccgagacgaaggtgttctgcggccacgagcacacgcttagcaacctggagtttgcccagaaagtggagccctgcaacgaccacgtgagagccaagctgtcctgggctaagaagagggatgaggatgacgtgcccactgtgccgtcgactctgggcgaggagcgcctctacaaccccttcctgcgggtggcagaggagccggtgcgcaagttcacgggcaaggcggtccccgccgacgtcctggaggcgctatgcaaggagcgggcgcgcttcgaacaggcgggcgagccgcggcagccacaggcgcgggccctccttgcgctgcagtgggggctcctgagtgcagccccacacgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: