RPE-ribulose-5-phosphate-3-epimerase Gene View larger

RPE-ribulose-5-phosphate-3-epimerase Gene

PTXBC005148

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPE-ribulose-5-phosphate-3-epimerase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPE-ribulose-5-phosphate-3-epimerase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005148
Product type: DNA & cDNA
Ncbi symbol: RPE
Origin species: Human
Product name: RPE-ribulose-5-phosphate-3-epimerase Gene
Size: 2ug
Accessions: BC005148
Gene id: 6120
Gene description: ribulose-5-phosphate-3-epimerase
Synonyms: RPE2-1; ribulose-phosphate 3-epimerase; ribulose-5-phosphate-3-epimerase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcgggctgcaagattggcccgtccatcctcaacagcgacctggccaatttaggggccgagtgcctccggatgctagactctggggccgattatctgcacctggacgtaatggacgggcattttgttcccaacatcacctttggtcaccctgtggtagaaagccttcgaaagcagctaggccaggaccctttctttgacatgcacatgatggtgtccaagccagaacagtgggtaaagccaatggctgtagcaggagccaatcagtacacctttcatctcgaggctactgagaacccaggggctttgattaaagacattcgggagaatgggatgaaggttggccttgccatcaaaccaggaacctcagttgagtatttggcaccatgggctaatcagatagatatggccttggttatgacagtggaaccggggtttggagggcagaaattcatggaagatatgatgccaaaggttcactggttgaggacccagttcccatctttggatatagaggtcgatggtggagtaggtcctgacactgtccataaatgtgcagaggcaggagctaacatgattgtgtctggcagtgctattatgaggagtgaagaccccagatctgtgatcaatctattaagaaatgtttgctcagaagctgctcagaaacgttctcttgatcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - linker for activation of T cells
- phosphatidylserine synthase 1
- adhesion regulating molecule 1
- Era G-protein-like 1 (E. coli)

Buy RPE-ribulose-5-phosphate-3-epimerase Gene now

Add to cart