ERAL1-Era G-protein-like 1 (E. coli) Gene View larger

ERAL1-Era G-protein-like 1 (E. coli) Gene

PTXBC019094

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERAL1-Era G-protein-like 1 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERAL1-Era G-protein-like 1 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019094
Product type: DNA & cDNA
Ncbi symbol: ERAL1
Origin species: Human
Product name: ERAL1-Era G-protein-like 1 (E. coli) Gene
Size: 2ug
Accessions: BC019094
Gene id: 26284
Gene description: Era G-protein-like 1 (E. coli)
Synonyms: CEGA; ERA-W; ERAL1A; H-ERA; HERA-A; HERA-B; GTPase Era, mitochondrial; ERA-like protein 1; Era G-protein-like 1; GTP-binding protein era homolog; GTPase, human homolog of E. coli essential cell cycle protein Era; conserved ERA-like GTPase; era (E. coli G-protein homolog)-like 1; Era like 12S mitochondrial rRNA chaperone 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccccagctggcgcggggctaggcttgttcaatcggtgttaagagtctggcaggtgggccctcatgtcgcgagggagcgggtgatccctttttcctcactcttaggcttccaacggaggtgcgtgtcctgcgtcgcggggtccgctttctctggtccccgcttggcctcggcttctcgcagtaatggccagggctctgccctggaccacttcctcggattctctcagcccgacagttcggtgactccttgcgtccccgcggtgtccatgaacagagatgagcaggatgtcctcttggtccatcaccctgatatgcctgagaattcccgggtcctacgagtggtcctcctgggagccccgaatgcagggaagtcaacactctccaaccagctactgggccgaaaggtgttccctgtttccaggaaggtgcatactactcgctgccaagctctgggggtcatcacagagaaggagacccaggtgattctacttgacacacctggcattatcagtcctggtaaacagaagaggcatcacctggagctctctttgttggaagatccatggaagagcatggaatctgctgatcttgttgtggttcttgtggatgtctcagacaagtggacacggaaccagctcagcccccagttgctcaggtgcttgaccaagtactcccagatccctagtgtcctggtcatgaacaaggtagattgtttgaagcagaagtcagttctcctggagctcacggcagccctcactgaaggtgtggtcaatggcaaaaagctcaagatgaggcaggccttccactcacaccctggcacccattgccccagcccagcagttaaggacccaaacacacaatctgtgggaaatcctcagaggattggctggccccacttcaaggagatcttcatgttgtcagccctaagccaggaggacgtgaaaacactaaagcaataccttctgacacaggcccagccagggccctgggagtaccacagtgcagtcctcactagccagacaccagaagagatctgtgccaacattatccgagagaagctcctagaacacctgccccaggaggtgccttacaatgtacagcagaagacagcagtgtgggaggaaggaccaggtggggagctggttatccaacagaagcttctggtgcccaaagaatcttatgtgaaactcctgattggtccgaagggccacgtgatctcccagatagcacaggaggcaggccatgacctcatggacatcttcctctgcgatgttgacatccgcctctctgtgaagctcctcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - porcupine homolog (Drosophila)
- pitrilysin metallopeptidase 1
- polo-like kinase 4 (Drosophila)
- ghrelin/obestatin prepropeptide

Buy ERAL1-Era G-protein-like 1 (E. coli) Gene now

Add to cart