Login to display prices
Login to display prices
LAT-linker for activation of T cells Gene View larger

LAT-linker for activation of T cells Gene

PTXBC011563

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LAT-linker for activation of T cells Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LAT-linker for activation of T cells Gene

Proteogenix catalog: PTXBC011563
Ncbi symbol: LAT
Product name: LAT-linker for activation of T cells Gene
Size: 2ug
Accessions: BC011563
Gene id: 27040
Gene description: linker for activation of T cells
Synonyms: LAT1; pp36; linker for activation of T-cells family member 1; 36 kDa phospho-tyrosine adapter protein; 36 kDa phospho-tyrosine adaptor protein; linker for activation of T cells, transmembrane adaptor; p36-38; linker for activation of T-cells
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggccatcctggtcccctgcgtgctggggctcctgctgctgcccatcctggccatgttgatggcactgtgtgtgcactgccacagactgccaggctcctacgacagcacatcctcagatagtttgtatccaaggggcatccagttcaaacggcctcacacggttgccccctggccacctgcctacccacctgtcacctcctacccacccctgagccagccagacctgctccccatcccaagatccccgcagccccttgggggctcccaccggacgccatcttcccggcgggattctgatggtgccaacagtgtggcgagctacgagaacgaggaaccagcctgtgaggatgcggatgaggatgaggacgactatcacaacccaggctacctggtggtgcttcctgacagcaccccggccactagcactgctgccccatcagctcctgcactcagcacccctggcatccgagacagtgccttctccatggagtccattgatgattacgtgaacgttccggagagcggggagagcgcagaagcgtctctggatggcagccgggagtatgtgaatgtgtcccaggaactgcatcctggagcggctaagactgagcctgccgccctgagttcccaggaggcagaggaagtggaggaagagggggctccagattacgagaatctgcaggagctgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: