LAT-linker for activation of T cells Gene View larger

LAT-linker for activation of T cells Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LAT-linker for activation of T cells Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LAT-linker for activation of T cells Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011563
Product type: DNA & cDNA
Ncbi symbol: LAT
Origin species: Human
Product name: LAT-linker for activation of T cells Gene
Size: 2ug
Accessions: BC011563
Gene id: 27040
Gene description: linker for activation of T cells
Synonyms: LAT1; pp36; linker for activation of T-cells family member 1; 36 kDa phospho-tyrosine adapter protein; 36 kDa phospho-tyrosine adaptor protein; linker for activation of T cells, transmembrane adaptor; p36-38; linker for activation of T-cells
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggccatcctggtcccctgcgtgctggggctcctgctgctgcccatcctggccatgttgatggcactgtgtgtgcactgccacagactgccaggctcctacgacagcacatcctcagatagtttgtatccaaggggcatccagttcaaacggcctcacacggttgccccctggccacctgcctacccacctgtcacctcctacccacccctgagccagccagacctgctccccatcccaagatccccgcagccccttgggggctcccaccggacgccatcttcccggcgggattctgatggtgccaacagtgtggcgagctacgagaacgaggaaccagcctgtgaggatgcggatgaggatgaggacgactatcacaacccaggctacctggtggtgcttcctgacagcaccccggccactagcactgctgccccatcagctcctgcactcagcacccctggcatccgagacagtgccttctccatggagtccattgatgattacgtgaacgttccggagagcggggagagcgcagaagcgtctctggatggcagccgggagtatgtgaatgtgtcccaggaactgcatcctggagcggctaagactgagcctgccgccctgagttcccaggaggcagaggaagtggaggaagagggggctccagattacgagaatctgcaggagctgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylserine synthase 1
- adhesion regulating molecule 1
- Era G-protein-like 1 (E. coli)
- porcupine homolog (Drosophila)

Buy LAT-linker for activation of T cells Gene now

Add to cart