Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LAT-linker for activation of T cells Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LAT-linker for activation of T cells Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011563 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LAT |
| Origin species: | Human |
| Product name: | LAT-linker for activation of T cells Gene |
| Size: | 2ug |
| Accessions: | BC011563 |
| Gene id: | 27040 |
| Gene description: | linker for activation of T cells |
| Synonyms: | LAT1; pp36; linker for activation of T-cells family member 1; 36 kDa phospho-tyrosine adapter protein; 36 kDa phospho-tyrosine adaptor protein; linker for activation of T cells, transmembrane adaptor; p36-38; linker for activation of T-cells |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggaggccatcctggtcccctgcgtgctggggctcctgctgctgcccatcctggccatgttgatggcactgtgtgtgcactgccacagactgccaggctcctacgacagcacatcctcagatagtttgtatccaaggggcatccagttcaaacggcctcacacggttgccccctggccacctgcctacccacctgtcacctcctacccacccctgagccagccagacctgctccccatcccaagatccccgcagccccttgggggctcccaccggacgccatcttcccggcgggattctgatggtgccaacagtgtggcgagctacgagaacgaggaaccagcctgtgaggatgcggatgaggatgaggacgactatcacaacccaggctacctggtggtgcttcctgacagcaccccggccactagcactgctgccccatcagctcctgcactcagcacccctggcatccgagacagtgccttctccatggagtccattgatgattacgtgaacgttccggagagcggggagagcgcagaagcgtctctggatggcagccgggagtatgtgaatgtgtcccaggaactgcatcctggagcggctaagactgagcctgccgccctgagttcccaggaggcagaggaagtggaggaagagggggctccagattacgagaatctgcaggagctgaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylserine synthase 1 - adhesion regulating molecule 1 - Era G-protein-like 1 (E. coli) - porcupine homolog (Drosophila) |