ADRM1-adhesion regulating molecule 1 Gene View larger

ADRM1-adhesion regulating molecule 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADRM1-adhesion regulating molecule 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ADRM1-adhesion regulating molecule 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017245
Product type: DNA & cDNA
Ncbi symbol: ADRM1
Origin species: Human
Product name: ADRM1-adhesion regulating molecule 1 Gene
Size: 2ug
Accessions: BC017245
Gene id: 11047
Gene description: adhesion regulating molecule 1
Synonyms: proteasomal ubiquitin receptor ADRM1; ARM-1; ARM1; GP110; 110 kDa cell membrane glycoprotein; M(r) 110,000 surface antigen; proteasome regulatory particle non-ATPase 13; rpn13 homolog; adhesion regulating molecule 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgacctcaggcgcgctctttccaagcctggtgccaggctctcggggcgcctccaacaagtacttggtggagtttcgggcgggaaagatgtccctgaaggggaccaccgtgactccggataagcggaaagggctggtgtacattcagcagacggacgactcgcttattcacttctgctggaaggacaggacgtccgggaacgtggaagacgacttgatcatcttccctgacgactgtgagttcaagcgggtgccgcagtgccccagcgggagggtctacgtgctgaagttcaaggcagggtccaagcggcttttcttctggatgcaggaacccaagacagaccaggatgaggagcattgccggaaagtcaacgagtatctgaacaaccccccgatgcctggggcactgggggccagcggaagcagcggccacgaactctctgcgctaggcggtgagggtggcctgcagagcctgctgggaaacatgagccacagccagctcatgcagctcatcggaccagccggcctcggaggactgggtgggctgggggccctgactggacctggcctggccagtttactggggagcagtgggcctccagggagcagctcctcctccagctcccggagccagtcggcagcggtcaccccgtcatccaccacctcttccacccgtgccaccccagccccttctgctccagcagctgcctcagcaactagcccgagccccgcgcccagttccgggaatggagccagcacagcagccagcccgacccagcccatccagctgagcgacctccagagcatcctggccacgatgaacgtaccagccgggccagcaggcggccagcaagtggacctggccagtgtgctgacgccggagataatggctcccatcctcgccaacgcggatgtccaggagcgcctgcttccctacttgccatctggggagtcgctgccgcagaccgcggatgagatccagaataccctgacctcgccccagttccagcaggccctgggcatgttcagcgcagccttggcctcggggcagctgggccccctcatgtgccagttcggtctgcctgcagaggctgtggaggccgccaacaagggcgatgtggaagcgtttgccaaagccatgcagaacaacgccaagcccgagcagaaagagggcgacacgaaggacaagaaggacgaagaggaggacatgagcctggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Era G-protein-like 1 (E. coli)
- porcupine homolog (Drosophila)
- pitrilysin metallopeptidase 1
- polo-like kinase 4 (Drosophila)

Buy ADRM1-adhesion regulating molecule 1 Gene now

Add to cart