TMEM43-transmembrane protein 43 Gene View larger

TMEM43-transmembrane protein 43 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM43-transmembrane protein 43 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM43-transmembrane protein 43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008054
Product type: DNA & cDNA
Ncbi symbol: TMEM43
Origin species: Human
Product name: TMEM43-transmembrane protein 43 Gene
Size: 2ug
Accessions: BC008054
Gene id: 79188
Gene description: transmembrane protein 43
Synonyms: ARVC5; ARVD5; EDMD7; LUMA; transmembrane protein 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtggagtcattcatggcaacagccccctttgtccaaattggcaggtttttcctctcgtcaggcctcatcgacaaagtcgacaacttcaagtccctgagcctatccaagctggaggaccctcatgtggacatcattcgccgtggagactttttctaccacagcgaaaatcccaagtatccagaggtgggagacttgcgtgtctccttttcctatgctggactgagcggcgatgaccctgacctgggcccagctcacgtggtcactgtgattgcccggcagcggggtgaccagctagtcccattctccaccaagtctggggataccttactgctcctgcaccacggggacttctcagcagaggaggtgtttcatagagaactaaggagcaactccatgaagacctggggcctgcgggcagctggctggatggccatgttcatgggcctcaaccttatgacacggatcctctacaccttggtggactggtttcctgttttccgagacctggtcaacattggcctgaaagcctttgccttctgtgtggccacctcgctgaccctgctgaccgtggcggctggctggctcttctaccgacccctgtgggccctcctcattgccggcctggcccttgtgcccatccttgttgctcggacacgggtgccagccaaaaagttggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mediator complex subunit 7
- thymidine kinase 1, soluble
- immunoglobulin kappa locus
- tubulin folding cofactor B

Buy TMEM43-transmembrane protein 43 Gene now

Add to cart