Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PXMP4-peroxisomal membrane protein 4, 24kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PXMP4-peroxisomal membrane protein 4, 24kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001147 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PXMP4 |
| Origin species: | Human |
| Product name: | PXMP4-peroxisomal membrane protein 4, 24kDa Gene |
| Size: | 2ug |
| Accessions: | BC001147 |
| Gene id: | 11264 |
| Gene description: | peroxisomal membrane protein 4, 24kDa |
| Synonyms: | PMP24; peroxisomal membrane protein 4; 24 kDa peroxisomal intrinsic membrane protein; peroxisomal membrane protein 4, 24kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagccccgccgcagctaagggctctgctcgtagtcgtcaacgcactgctgcgcaagcgccgctaccacgctgcgttggccgtgcttaagggcttccggaacggggctgtctatggagccaaaatccgggcccctcacgcgctggtcatgacctttctcttccggaatggcagcctccaggagaagctgtgggccatactgcaggccacatatatccactcctggaacctggcacggtttgtgttcacctacaagggtctccgtgccctgcagtcctacatacaaggcaagacctacccagcacacgcattcctggcggccttcctcgggggtatcctggtgtttggagaaaacaataacatcaacagccagatcaacatgtacctgttgtcacgcgtcctgtttgccctgagccgcctggctgtagagaagggctacatccctgaacccaggtgggacccgttcccgctgctcactgcggtggtgtgggggctggtgctgtggctctttgagtatcaccgatccaccctgcagccctcgctgcagtcctccatgacctacctctatgaggacagcaatgtatggcacgacatctcagacttcctcatctataacaagagccgtccctccaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth factor receptor-bound protein 2 - DIRAS family, GTP-binding RAS-like 3 - hydroxyacylglutathione hydrolase-like - NOL1/NOP2/Sun domain family, member 4 |