Login to display prices
Login to display prices
PXMP4-peroxisomal membrane protein 4, 24kDa Gene View larger

PXMP4-peroxisomal membrane protein 4, 24kDa Gene

PTXBC001147

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PXMP4-peroxisomal membrane protein 4, 24kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PXMP4-peroxisomal membrane protein 4, 24kDa Gene

Proteogenix catalog: PTXBC001147
Ncbi symbol: PXMP4
Product name: PXMP4-peroxisomal membrane protein 4, 24kDa Gene
Size: 2ug
Accessions: BC001147
Gene id: 11264
Gene description: peroxisomal membrane protein 4, 24kDa
Synonyms: PMP24; peroxisomal membrane protein 4; 24 kDa peroxisomal intrinsic membrane protein; peroxisomal membrane protein 4, 24kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagccccgccgcagctaagggctctgctcgtagtcgtcaacgcactgctgcgcaagcgccgctaccacgctgcgttggccgtgcttaagggcttccggaacggggctgtctatggagccaaaatccgggcccctcacgcgctggtcatgacctttctcttccggaatggcagcctccaggagaagctgtgggccatactgcaggccacatatatccactcctggaacctggcacggtttgtgttcacctacaagggtctccgtgccctgcagtcctacatacaaggcaagacctacccagcacacgcattcctggcggccttcctcgggggtatcctggtgtttggagaaaacaataacatcaacagccagatcaacatgtacctgttgtcacgcgtcctgtttgccctgagccgcctggctgtagagaagggctacatccctgaacccaggtgggacccgttcccgctgctcactgcggtggtgtgggggctggtgctgtggctctttgagtatcaccgatccaccctgcagccctcgctgcagtcctccatgacctacctctatgaggacagcaatgtatggcacgacatctcagacttcctcatctataacaagagccgtccctccaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: