Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene
PTXBC021972
New product
Data sheet of TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021972 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAF11 |
| Origin species: | Human |
| Product name: | TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene |
| Size: | 2ug |
| Accessions: | BC021972 |
| Gene id: | 6882 |
| Gene description: | TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa |
| Synonyms: | TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa; MGC:15243; PRO2134; TAF2I; TAFII28; transcription initiation factor TFIID subunit 11; TAF(II)28; TAFII-28; TATA box binding protein (TBP)-associated factor, RNA polymerase II, I, 28kD; TFIID subunit p30-beta; transcription initiation factor TFIID 28 kD subunit; transcription initiation factor TFIID 28 kDa subunit; TATA-box binding protein associated factor 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgatgcccacgagtcgccctccgacaaaggtggagagacaggggagtcggatgagacggccgctgtgcccggggacccgggggctaccgacaccgatggaatcccagaggaaactgacggagacgcagatgtggacttgaaagaagctgcagcggaggaaggcgagctcgagagtcaggatgtctcagatttaacaacagttgaaagggaagactcatcattacttaatcctgcagccaaaaaactgaaaatagataccaaagaaaagaaagagaaaaagcagaaagtagatgaagatgagattcagaagatgcaaatcctggtttcttctttttctgaggagcagctgaaccgttatgaaatgtatcgccgctcagctttccctaaggcagccatcaaaaggctgatccagtccatcactggcacctctgtgtctcagaatgttgttattgctatgtctggtatttccaaggttttcgtcggggaggtggtagaagaagcactggatgtgtgtgagaagtggggagaaatgccaccactacaacccaaacatatgagggaagccgttagaaggttaaagtcaaaaggacagatccctaactcgaagcacaaaaaaatcatcttcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal transducer and activator of transcription 3 (acute-phase response factor) - TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa - 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) - glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) |