TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene View larger

TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021972
Product type: DNA & cDNA
Ncbi symbol: TAF11
Origin species: Human
Product name: TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene
Size: 2ug
Accessions: BC021972
Gene id: 6882
Gene description: TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
Synonyms: TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa; MGC:15243; PRO2134; TAF2I; TAFII28; transcription initiation factor TFIID subunit 11; TAF(II)28; TAFII-28; TATA box binding protein (TBP)-associated factor, RNA polymerase II, I, 28kD; TFIID subunit p30-beta; transcription initiation factor TFIID 28 kD subunit; transcription initiation factor TFIID 28 kDa subunit; TATA-box binding protein associated factor 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgatgcccacgagtcgccctccgacaaaggtggagagacaggggagtcggatgagacggccgctgtgcccggggacccgggggctaccgacaccgatggaatcccagaggaaactgacggagacgcagatgtggacttgaaagaagctgcagcggaggaaggcgagctcgagagtcaggatgtctcagatttaacaacagttgaaagggaagactcatcattacttaatcctgcagccaaaaaactgaaaatagataccaaagaaaagaaagagaaaaagcagaaagtagatgaagatgagattcagaagatgcaaatcctggtttcttctttttctgaggagcagctgaaccgttatgaaatgtatcgccgctcagctttccctaaggcagccatcaaaaggctgatccagtccatcactggcacctctgtgtctcagaatgttgttattgctatgtctggtatttccaaggttttcgtcggggaggtggtagaagaagcactggatgtgtgtgagaagtggggagaaatgccaccactacaacccaaacatatgagggaagccgttagaaggttaaagtcaaaaggacagatccctaactcgaagcacaaaaaaatcatcttcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - signal transducer and activator of transcription 3 (acute-phase response factor)
- TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
- 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
- glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)

Buy TAF11-TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa Gene now

Add to cart