Login to display prices
Login to display prices
ARMC7-armadillo repeat containing 7 Gene View larger

ARMC7-armadillo repeat containing 7 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARMC7-armadillo repeat containing 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARMC7-armadillo repeat containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011728
Product type: DNA & cDNA
Ncbi symbol: ARMC7
Origin species: Human
Product name: ARMC7-armadillo repeat containing 7 Gene
Size: 2ug
Accessions: BC011728
Gene id: 79637
Gene description: armadillo repeat containing 7
Synonyms: armadillo repeat-containing protein 7; armadillo repeat containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccagaagccgaaggtggacccccacgtcgggcggctgggatacctgcaggcgctggtcacggaattccaggagacccaaagccaagacgccaaggagcaagtcctcgccaacctcgccaacttcgcttatgaccccagcaactacgagtatctgcggcagctgcaggtcctggatttatttctcgattcgctgtcggaggagaatgagaccctggtggagtttgctattggaggcctgtgcaacctgtgcccagacagggccaacaaggagcacatcctgcacgcaggaggtgtcccactcatcatcaactgcctatccagccccaatgaggagacggtgctgtctgccatcaccacgctcatgcacctgagcccgccgggccgcagctttctcccagagctgaccgccacgcccgtggtgcagtgcatgcttcgcttctccctctcggccagcgccaggctccggaacctggcacagatcttcctggaggacttctgctccccccgccaggtggccgaggcccgcagccggcaggcgcactctgccctgggtatcccactgccgaggagcgtggccccacggcagcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromatin modifying protein 6
- transmembrane protein 176A
- thiopurine S-methyltransferase
- BCL2-like 12 (proline rich)