Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene
PTXBC011739
New product
Data sheet of APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011739 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APOBEC3C |
| Origin species: | Human |
| Product name: | APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene |
| Size: | 2ug |
| Accessions: | BC011739 |
| Gene id: | 27350 |
| Gene description: | apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C |
| Synonyms: | A3C; APOBEC1L; ARDC2; ARDC4; ARP5; PBI; bK150C2.3; DNA dC->dU-editing enzyme APOBEC-3C; apolipoprotein B editing enzyme catalytic polypeptide-like 3C; apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C; phorbolin I; apolipoprotein B mRNA editing enzyme catalytic subunit 3C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatccacagatcagaaacccgatgaaggcaatgtatccaggcacattctacttccaatttaaaaacctatgggaagccaacgatcgggacgaaacttggctgtgcttcaccgtggaaggtataaagcgccgctcagttgtctcctggaagacgggcgtcttccgaaaccaggtggattctgagacccattgtcatgcagaaaggtgcttcctctcttggttctgcgacgacatactgtctcctaacacaaagtaccaggtcacctggtacacatcttggagcccttgcccagactgtgcaggggaggtggccgagttcctggccaggcacagcaacgtgaatctcaccatcttcaccgcccgcctctactacttccagtatccatgttaccaggaggggctccgcagcctgagtcaggaaggggtcgctgtggagatcatggactatgaagattttaaatattgttgggaaaactttgtgtacaatgataatgagccattcaagccttggaagggattaaaaaccaactttcgacttctgaaaagaaggctacgggagagtctccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform - achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) - hyperpolarization activated cyclic nucleotide-gated potassium channel 3 - ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit |