APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene View larger

APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene

PTXBC011739

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011739
Product type: DNA & cDNA
Ncbi symbol: APOBEC3C
Origin species: Human
Product name: APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene
Size: 2ug
Accessions: BC011739
Gene id: 27350
Gene description: apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C
Synonyms: A3C; APOBEC1L; ARDC2; ARDC4; ARP5; PBI; bK150C2.3; DNA dC->dU-editing enzyme APOBEC-3C; apolipoprotein B editing enzyme catalytic polypeptide-like 3C; apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C; phorbolin I; apolipoprotein B mRNA editing enzyme catalytic subunit 3C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccacagatcagaaacccgatgaaggcaatgtatccaggcacattctacttccaatttaaaaacctatgggaagccaacgatcgggacgaaacttggctgtgcttcaccgtggaaggtataaagcgccgctcagttgtctcctggaagacgggcgtcttccgaaaccaggtggattctgagacccattgtcatgcagaaaggtgcttcctctcttggttctgcgacgacatactgtctcctaacacaaagtaccaggtcacctggtacacatcttggagcccttgcccagactgtgcaggggaggtggccgagttcctggccaggcacagcaacgtgaatctcaccatcttcaccgcccgcctctactacttccagtatccatgttaccaggaggggctccgcagcctgagtcaggaaggggtcgctgtggagatcatggactatgaagattttaaatattgttgggaaaactttgtgtacaatgataatgagccattcaagccttggaagggattaaaaaccaactttcgacttctgaaaagaaggctacgggagagtctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
- achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
- hyperpolarization activated cyclic nucleotide-gated potassium channel 3
- ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit

Buy APOBEC3C-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C Gene now

Add to cart