ARL2-ADP-ribosylation factor-like 2 Gene View larger

ARL2-ADP-ribosylation factor-like 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL2-ADP-ribosylation factor-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARL2-ADP-ribosylation factor-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002530
Product type: DNA & cDNA
Ncbi symbol: ARL2
Origin species: Human
Product name: ARL2-ADP-ribosylation factor-like 2 Gene
Size: 2ug
Accessions: BC002530
Gene id: 402
Gene description: ADP-ribosylation factor-like 2
Synonyms: ARFL2; ADP-ribosylation factor-like protein 2; ADP-ribosylation factor-like 2; ADP ribosylation factor like GTPase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctcctgaccattctgaagaagatgaagcagaaagagcgggagctgcgactgctcatgcttggcctggacaatgctggaaagacaaccatcctgaagaagttcaatggggaggacatcgacaccatctccccaacgctgggcttcaacatcaagaccctggagcaccgaggattcaagctgaacatctgggatgtgggtggccagaagtccctgcggtcctactggcggaactactttgagagcaccgatggcctcatctgggtagtggacagcgcagaccgccagcgcatgcaggactgccagcgggagctccagagcctgctggtggaggagcgcctggccggagcaaccctcctcatctttgctaataagcaggacctgcctggagcactgtcctctaacgccatccgcgaggtcctggagctggactccatccgcagccaccactggtgcatccagggctgcagcgccgtcaccggggagaacctgctgccgggcatcgactggctcctggatgacatttccagccgcattttcacagctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - armadillo repeat containing 7
- chromatin modifying protein 6
- transmembrane protein 176A
- thiopurine S-methyltransferase

Buy ARL2-ADP-ribosylation factor-like 2 Gene now

Add to cart