Login to display prices
Login to display prices
ARL2-ADP-ribosylation factor-like 2 Gene View larger

ARL2-ADP-ribosylation factor-like 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL2-ADP-ribosylation factor-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARL2-ADP-ribosylation factor-like 2 Gene

Proteogenix catalog: PTXBC002530
Ncbi symbol: ARL2
Product name: ARL2-ADP-ribosylation factor-like 2 Gene
Size: 2ug
Accessions: BC002530
Gene id: 402
Gene description: ADP-ribosylation factor-like 2
Synonyms: ARFL2; ADP-ribosylation factor-like protein 2; ADP-ribosylation factor-like 2; ADP ribosylation factor like GTPase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctcctgaccattctgaagaagatgaagcagaaagagcgggagctgcgactgctcatgcttggcctggacaatgctggaaagacaaccatcctgaagaagttcaatggggaggacatcgacaccatctccccaacgctgggcttcaacatcaagaccctggagcaccgaggattcaagctgaacatctgggatgtgggtggccagaagtccctgcggtcctactggcggaactactttgagagcaccgatggcctcatctgggtagtggacagcgcagaccgccagcgcatgcaggactgccagcgggagctccagagcctgctggtggaggagcgcctggccggagcaaccctcctcatctttgctaataagcaggacctgcctggagcactgtcctctaacgccatccgcgaggtcctggagctggactccatccgcagccaccactggtgcatccagggctgcagcgccgtcaccggggagaacctgctgccgggcatcgactggctcctggatgacatttccagccgcattttcacagctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: