Login to display prices
Login to display prices
CD160-CD160 molecule Gene View larger

CD160-CD160 molecule Gene

PTXBC014465

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD160-CD160 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD160-CD160 molecule Gene

Proteogenix catalog: PTXBC014465
Ncbi symbol: CD160
Product name: CD160-CD160 molecule Gene
Size: 2ug
Accessions: BC014465
Gene id: 11126
Gene description: CD160 molecule
Synonyms: CD160 molecule; CD160-delta Ig; CD160 transmembrane isoform; CD160 antigen; NK1; NK28; natural killer cell receptor BY55; natural killer cell receptor, immunoglobulin superfamily member
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgttggaacccggcagaggctgctgtgccctggccatcctgctggcaattgtggacatccagtctggtggatgcattaacatcaccagctcagcttcccaggaaggaacgcgactaaacttaatctgtactgtatggcataagaaagaagaggctgaggggtttgtagtgtttttgtgcaaggacaggtctggagactgttctcctgagaccagtttaaaacagctgagacttaaaagggatcctgggatagatggtgttggtgaaatatcatctcagttgatgttcaccataagccaagtcacaccgttgcacagtgggacctaccagtgttgtgccagaagccagaagtcaggtatccgccttcagggccattttttctccattctattcacagagacagggaactacacagtgacgggattgaaacaaagacaacaccttgagttcagccataatgaaggcactctcagttcaggcttcctacaagaaaaggtctgggtaatgctggtcaccagccttgtggcccttcaagctttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: