Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD160-CD160 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD160-CD160 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014465 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD160 |
| Origin species: | Human |
| Product name: | CD160-CD160 molecule Gene |
| Size: | 2ug |
| Accessions: | BC014465 |
| Gene id: | 11126 |
| Gene description: | CD160 molecule |
| Synonyms: | CD160 molecule; CD160-delta Ig; CD160 transmembrane isoform; CD160 antigen; NK1; NK28; natural killer cell receptor BY55; natural killer cell receptor, immunoglobulin superfamily member |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgttggaacccggcagaggctgctgtgccctggccatcctgctggcaattgtggacatccagtctggtggatgcattaacatcaccagctcagcttcccaggaaggaacgcgactaaacttaatctgtactgtatggcataagaaagaagaggctgaggggtttgtagtgtttttgtgcaaggacaggtctggagactgttctcctgagaccagtttaaaacagctgagacttaaaagggatcctgggatagatggtgttggtgaaatatcatctcagttgatgttcaccataagccaagtcacaccgttgcacagtgggacctaccagtgttgtgccagaagccagaagtcaggtatccgccttcagggccattttttctccattctattcacagagacagggaactacacagtgacgggattgaaacaaagacaacaccttgagttcagccataatgaaggcactctcagttcaggcttcctacaagaaaaggtctgggtaatgctggtcaccagccttgtggcccttcaagctttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tetraspanin 2 - tetraspanin 8 - tetraspanin 4 - tetraspanin 1 |