Login to display prices
Login to display prices
ISG15-ISG15 ubiquitin-like modifier Gene View larger

ISG15-ISG15 ubiquitin-like modifier Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ISG15-ISG15 ubiquitin-like modifier Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ISG15-ISG15 ubiquitin-like modifier Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009507
Product type: DNA & cDNA
Ncbi symbol: ISG15
Origin species: Human
Product name: ISG15-ISG15 ubiquitin-like modifier Gene
Size: 2ug
Accessions: BC009507
Gene id: 9636
Gene description: ISG15 ubiquitin-like modifier
Synonyms: ISG15 ubiquitin-like modifier; ubiquitin-like protein ISG15; G1P2; IFI15; IMD38; IP17; UCRP; hUCRP; interferon, alpha-inducible protein (clone IFI-15K); interferon-induced 17-kDa/15-kDa protein; interferon-stimulated protein, 15 kDa; ubiquitin cross-reactive protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgggacctgacggtgaagatgctggcgggcaacgaattccaggtgtccctgagcagctccatgtcggtgtcagagctgaaggcgcagatcacccagaagatcggcgtgcacgccttccagcagcgtctggctgtccacccgagcggtgtggcgctgcaggacagggtcccccttgccagccagggcctgggccccggcagcacggtcctgctggtggtggacaaatgcgacgaacctctgaacatcctggtgaggaataacaagggccgcagcagcacctacgaggtgcggctgacgcagaccgtggcccacctgaagcagcaagtgagcgggctggagggtgtgcaggacgacctgttctggctgaccttcgaggggaagcccctggaggaccagctcccgctgggggagtacggcctcaagcccctgagcaccgtgttcatgaatctgcgcctgcggggaggcggcacagagcctggcgggcggagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 2
- armadillo repeat containing 7
- chromatin modifying protein 6
- transmembrane protein 176A