FAM96B-family with sequence similarity 96, member B Gene View larger

FAM96B-family with sequence similarity 96, member B Gene

PTXBC001733

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM96B-family with sequence similarity 96, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM96B-family with sequence similarity 96, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001733
Product type: DNA & cDNA
Ncbi symbol: FAM96B
Origin species: Human
Product name: FAM96B-family with sequence similarity 96, member B Gene
Size: 2ug
Accessions: BC001733
Gene id: 51647
Gene description: family with sequence similarity 96, member B
Synonyms: CGI-128; CIA2B; MIP18; mitotic spindle-associated MMXD complex subunit MIP18; MSS19-interacting protein of 18 kDa; family with sequence similarity 96 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtaggcggcggcggggtcggcggcggcctcctggagaatgccaaccccctcatctaccagcgctctggggagcggcctgtgacggcaggcgaggaggacgagcaggttcccgacagcatcgacgcacgcgagatcttcgatctgattcgctccatcaatgacccggagcatccactgacgctagaggagttgaacgtagtagagcaggtgcgggttcaggttagcgaccccgagagtacagtggctgtggctttcacaccaaccattccgcactgcagcatggccacccttattggtctgtccatcaaggtcaagcttctgcgctcccttcctcagcgtttcaagatggacgtgcacattactccggggacccatgcctcagagcatgcagtgaacaagcaacttgcagataaggagcgggtggcagctgccctggagaacacccacctcttggaggttgtgaatcagtgcctgtcagcccgctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase (cyclophilin)-like 1
- iron-sulfur cluster scaffold homolog (E. coli)
- PRKR interacting protein 1 (IL11 inducible)
- glucosamine-phosphate N-acetyltransferase 1

Buy FAM96B-family with sequence similarity 96, member B Gene now

Add to cart