AP1S2-adaptor-related protein complex 1, sigma 2 subunit Gene View larger

AP1S2-adaptor-related protein complex 1, sigma 2 subunit Gene

PTXBC001117

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AP1S2-adaptor-related protein complex 1, sigma 2 subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AP1S2-adaptor-related protein complex 1, sigma 2 subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001117
Product type: DNA & cDNA
Ncbi symbol: AP1S2
Origin species: Human
Product name: AP1S2-adaptor-related protein complex 1, sigma 2 subunit Gene
Size: 2ug
Accessions: BC001117
Gene id: 8905
Gene description: adaptor-related protein complex 1, sigma 2 subunit
Synonyms: DC22; MRX59; MRXS21; MRXS5; MRXSF; PGS; SIGMA1B; AP-1 complex subunit sigma-2; adapter-related protein complex 1 sigma-1B subunit; adaptor protein complex AP-1 sigma-1B subunit; adaptor-related protein complex 1 subunit sigma-1B; clathrin adaptor complex AP1 sigma 1B subunit; clathrin assembly protein complex 1 sigma-1B small chain; golgi adaptor HA1/AP1 adaptin sigma-1B subunit; sigma1B-adaptin; adaptor related protein complex 1 sigma 2 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtttatgttgctttttagtcgtcagggaaagcttcgactgcaaaaatggtatgtcccactatcagacaaagagaagaaaaagatcacaagagaacttgttcagaccgttttagcacggaaacctaaaatgtgcagcttccttgagtggcgagatctgaagattgtttacaaaagatatgctagtctgtatttttgctgtgctattgaggatcaggacaatgaactaattaccctggaaataattcatcgttatgtggaattacttgacaagtatttcggcagtgtctgtgaactagatatcatctttaattttgagaaggcttattttattttggatgagtttcttttgggaggggaagttcaggaaacatccaagaaaaatgtccttaaagcaattgagcaggctgatctactgcaggaggaagctgaaaccccacgtagtgttcttgaagaaattggactgacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adaptor-related protein complex 3, sigma 2 subunit
- origin recognition complex, subunit 4-like (yeast)
- cholinergic receptor, nicotinic, alpha 1 (muscle)
- phosphoenolpyruvate carboxykinase 2 (mitochondrial)

Buy AP1S2-adaptor-related protein complex 1, sigma 2 subunit Gene now

Add to cart