Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene
PTXBC002785
New product
Data sheet of AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002785 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP3S2 |
| Origin species: | Human |
| Product name: | AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene |
| Size: | 2ug |
| Accessions: | BC002785 |
| Gene id: | 10239 |
| Gene description: | adaptor-related protein complex 3, sigma 2 subunit |
| Synonyms: | AP3S3; sigma3b; AP-3 complex subunit sigma-2; AP-3 complex subunit sigma-3B; adapter-related protein complex 3 subunit sigma-2; adaptor complex sigma3B; adaptor-related protein complex 3 subunit sigma-2; clathrin-associated/assembly/adaptor protein, small 4, 22-kD; sigma-3B-adaptin; sigma-adaptin 3b; adaptor related protein complex 3 sigma 2 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattcaggcgattctggttttcaacaaccatgggaagccacggctagtccgcttctaccagcgtttcccagaagaaattcaacagcagattgttcgagagactttccatctagtcctcaagcgggatgacaacatctgtaacttcttggagggtggaagtttgattggtggctctgactacaaactgatctaccggcactatgctaccctctactttgtattttgtgtggattcctcagagagtgaacttggaatcttggacctcatccaggtttttgtggaaactctggataagtgtttcgaaaatgtgtgtgaattggatttgatcttccatatggataaggtgcactacatcctccaggaggtggtgatgggtgggatggtgttggaaacaaacatgaatgaaatcgtggctcagattgaggctcaaaacaggctggagaaatccgagggtggcctttcagcagcccctgcgcgggctgtgtctgctgtgaaaaacatcaacctgccagagattcctcggaacatcaacattggcgatctcaacatcaaagttcccaacctgtcccagtttgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - origin recognition complex, subunit 4-like (yeast) - cholinergic receptor, nicotinic, alpha 1 (muscle) - phosphoenolpyruvate carboxykinase 2 (mitochondrial) - procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 |