Login to display prices
Login to display prices
AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene View larger

AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002785
Product type: DNA & cDNA
Ncbi symbol: AP3S2
Origin species: Human
Product name: AP3S2-adaptor-related protein complex 3, sigma 2 subunit Gene
Size: 2ug
Accessions: BC002785
Gene id: 10239
Gene description: adaptor-related protein complex 3, sigma 2 subunit
Synonyms: AP3S3; sigma3b; AP-3 complex subunit sigma-2; AP-3 complex subunit sigma-3B; adapter-related protein complex 3 subunit sigma-2; adaptor complex sigma3B; adaptor-related protein complex 3 subunit sigma-2; clathrin-associated/assembly/adaptor protein, small 4, 22-kD; sigma-3B-adaptin; sigma-adaptin 3b; adaptor related protein complex 3 sigma 2 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattcaggcgattctggttttcaacaaccatgggaagccacggctagtccgcttctaccagcgtttcccagaagaaattcaacagcagattgttcgagagactttccatctagtcctcaagcgggatgacaacatctgtaacttcttggagggtggaagtttgattggtggctctgactacaaactgatctaccggcactatgctaccctctactttgtattttgtgtggattcctcagagagtgaacttggaatcttggacctcatccaggtttttgtggaaactctggataagtgtttcgaaaatgtgtgtgaattggatttgatcttccatatggataaggtgcactacatcctccaggaggtggtgatgggtgggatggtgttggaaacaaacatgaatgaaatcgtggctcagattgaggctcaaaacaggctggagaaatccgagggtggcctttcagcagcccctgcgcgggctgtgtctgctgtgaaaaacatcaacctgccagagattcctcggaacatcaacattggcgatctcaacatcaaagttcccaacctgtcccagtttgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - origin recognition complex, subunit 4-like (yeast)
- cholinergic receptor, nicotinic, alpha 1 (muscle)
- phosphoenolpyruvate carboxykinase 2 (mitochondrial)
- procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2