ORC4L-origin recognition complex, subunit 4-like (yeast) Gene View larger

ORC4L-origin recognition complex, subunit 4-like (yeast) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ORC4L-origin recognition complex, subunit 4-like (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ORC4L-origin recognition complex, subunit 4-like (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005388
Product type: DNA & cDNA
Ncbi symbol: ORC4L
Origin species: Human
Product name: ORC4L-origin recognition complex, subunit 4-like (yeast) Gene
Size: 2ug
Accessions: BC005388
Gene id: 5000
Gene description: origin recognition complex, subunit 4-like (yeast)
Synonyms: ORC4L; ORC4P; origin recognition complex subunit 4; origin recognition complex, subunit 4 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagtcgtaaatcaaagagtaacagcttaattcacacagagtgcctttcacaggtacaaagaattttacgtgaaagattttgtcgtcagagtccacatagtaacctatttggagtgcaagtacaatacaaacacttaagtgagctgctgaaaagaactgctctccatggagagagtaactctgtccttattatcggaccccgaggatcaggaaaaactatgttaataagtcatgctttgaaagaactcatggaaatagaagaagtgagtgaaaatgtattacaagttcacttaaatggactgctgcagatcaatgacaaaatcgccctaaaggaaatcacaaggcagttaaatctggaaaatgtagttggagataaagtttttggaagctttgctgaaaacctttcatttcttctggaagctttaaaaaaaggtgaccgaactagcagttgcccagtgatcttcatattagatgaatttgatctttttgctcatcataaaaaccaaacacttctctataatctttttgacatttctcagtctgcacagaccccaatagcagttattggtcttacatgtagattggatattttggaactcttagaaaaaagagtgaagtcaagattttctcaccggcagatacacttaatgaattcatttggttttccacagtatgttaaaatatttaaagaacagttatctctacctgcagagtttccagacaaggtttttgctgagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cholinergic receptor, nicotinic, alpha 1 (muscle)
- phosphoenolpyruvate carboxykinase 2 (mitochondrial)
- procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
- Rho guanine nucleotide exchange factor (GEF) 15

Buy ORC4L-origin recognition complex, subunit 4-like (yeast) Gene now

Add to cart