Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene
PTXBC006314
New product
Data sheet of CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006314 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHRNA1 |
| Origin species: | Human |
| Product name: | CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene |
| Size: | 2ug |
| Accessions: | BC006314 |
| Gene id: | 1134 |
| Gene description: | cholinergic receptor, nicotinic, alpha 1 (muscle) |
| Synonyms: | ACHRA; ACHRD; CHRNA; CMS1A; CMS1B; CMS2A; FCCMS; SCCMS; acetylcholine receptor subunit alpha; acetylcholine receptor, nicotinic, alpha 1 (muscle); cholinergic receptor, nicotinic alpha 1; cholinergic receptor, nicotinic, alpha 1 (muscle); cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle); muscle nicotinic acetylcholine receptor; nicotinic acetylcholine receptor alpha subunit; nicotinic cholinergic receptor alpha 1; cholinergic receptor nicotinic alpha 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccctggcctctcctcctgctctttagcctttgctcagctggcctcgtcctgggctccgaacatgagacccgtctggtggcaaagctatttaaagactacagcagcgtggtgcggccagtggaagaccaccgccaggtcgtggaggtcaccgtgggcctgcagctgatacagctcatcaatgtggatgaagtaaatcagatcgtgacaaccaatgtgcgtctgaaacagcaatgggtggattacaacctaaaatggaatccagatgactatggcggtgtgaaaaaaattcacattccttcagaaaagatctggcgcccagaccttgttctctataacaatgcagatggtgactttgctattgtcaagttcaccaaagtgctcctgcagtacactggccacatcacgtggacacctccagccatctttaaaagctactgtgagatcatcgtcacccactttccctttgatgaacagaactgcagcatgaagctgggcacctggacctacgacggctctgtcgtggccatcaacccggaaagcgaccagccagacctgagcaacttcatggagagcggggagtgggtgatcaaggagtcccggggctggaagcactccgtgacctattcctgctgccccgacaccccctacctggacatcacctaccacttcgtcatgcagcgcctgcccctctacttcatcgtcaacgtcatcatcccctgcctgctcttctccttcttaactggcctggtattctacctgcccacagactcaggtgggtgtggttgccatgactgctgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoenolpyruvate carboxykinase 2 (mitochondrial) - procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 - Rho guanine nucleotide exchange factor (GEF) 15 - adaptor-related protein complex 2, alpha 2 subunit |