Login to display prices
Login to display prices
CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene View larger

CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene

PTXBC006314

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene

Proteogenix catalog: PTXBC006314
Ncbi symbol: CHRNA1
Product name: CHRNA1-cholinergic receptor, nicotinic, alpha 1 (muscle) Gene
Size: 2ug
Accessions: BC006314
Gene id: 1134
Gene description: cholinergic receptor, nicotinic, alpha 1 (muscle)
Synonyms: ACHRA; ACHRD; CHRNA; CMS1A; CMS1B; CMS2A; FCCMS; SCCMS; acetylcholine receptor subunit alpha; acetylcholine receptor, nicotinic, alpha 1 (muscle); cholinergic receptor, nicotinic alpha 1; cholinergic receptor, nicotinic, alpha 1 (muscle); cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle); muscle nicotinic acetylcholine receptor; nicotinic acetylcholine receptor alpha subunit; nicotinic cholinergic receptor alpha 1; cholinergic receptor nicotinic alpha 1 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccctggcctctcctcctgctctttagcctttgctcagctggcctcgtcctgggctccgaacatgagacccgtctggtggcaaagctatttaaagactacagcagcgtggtgcggccagtggaagaccaccgccaggtcgtggaggtcaccgtgggcctgcagctgatacagctcatcaatgtggatgaagtaaatcagatcgtgacaaccaatgtgcgtctgaaacagcaatgggtggattacaacctaaaatggaatccagatgactatggcggtgtgaaaaaaattcacattccttcagaaaagatctggcgcccagaccttgttctctataacaatgcagatggtgactttgctattgtcaagttcaccaaagtgctcctgcagtacactggccacatcacgtggacacctccagccatctttaaaagctactgtgagatcatcgtcacccactttccctttgatgaacagaactgcagcatgaagctgggcacctggacctacgacggctctgtcgtggccatcaacccggaaagcgaccagccagacctgagcaacttcatggagagcggggagtgggtgatcaaggagtcccggggctggaagcactccgtgacctattcctgctgccccgacaccccctacctggacatcacctaccacttcgtcatgcagcgcctgcccctctacttcatcgtcaacgtcatcatcccctgcctgctcttctccttcttaactggcctggtattctacctgcccacagactcaggtgggtgtggttgccatgactgctgctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: