Login to display prices
Login to display prices
ORMDL2-ORM1-like 2 (S. cerevisiae) Gene View larger

ORMDL2-ORM1-like 2 (S. cerevisiae) Gene

PTXBC012543

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ORMDL2-ORM1-like 2 (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ORMDL2-ORM1-like 2 (S. cerevisiae) Gene

Proteogenix catalog: PTXBC012543
Ncbi symbol: ORMDL2
Product name: ORMDL2-ORM1-like 2 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012543
Gene id: 29095
Gene description: ORM1-like 2 (S. cerevisiae)
Synonyms: HSPC160; MST095; MSTP095; adoplin-2; ORM1-like protein 2; expressed in normal aorta; ORMDL sphingolipid biosynthesis regulator 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgtgggggtggcacacagcgaagtaaaccccaacacccgagtgatgaatagccgaggcatctggctggcctacatcatcttggtaggattgctgcatatggttctactcagcatccccttcttcagcattcctgttgtctggaccctgaccaacgtcatccataacctggctacgtatgtcttccttcatacggtgaaagggacaccctttgagactcctgaccaaggaaaggcccggctactgacacactgggagcaaatggactatgggctccagtttacctcttcccgcaagttcctcagcatctctcctattgtgctctatctcctggccagcttctataccaagtatgatgctgcgcacttcctcatcaacacagcctcattgctaagtgtactgctgccgaagttgccccagttccatggggttcgtgtctttggcatcaacaaatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: