Login to display prices
Login to display prices
CTA-216E10.6-hypothetical FLJ23584 Gene View larger

CTA-216E10.6-hypothetical FLJ23584 Gene

PTXBC007210

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTA-216E10.6-hypothetical FLJ23584 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTA-216E10.6-hypothetical FLJ23584 Gene

Proteogenix catalog: PTXBC007210
Ncbi symbol: CTA-216E10.6
Product name: CTA-216E10.6-hypothetical FLJ23584 Gene
Size: 2ug
Accessions: BC007210
Gene id: 79640
Gene description: hypothetical FLJ23584
Synonyms: CTA-216E10.6; uncharacterized protein C22orf46; chromosome 22 open reading frame 46
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcctgtcccccactggggtgaagtcttcctgctggtgggtggggagggagagcatctggccagccagggcacaacccctgccagggatcatagagtggggatcagtccagcctcccagcaggcccaacctgaatcctggagaagacgacaaagggacaaaggggtggatccagagaaggcccccagcctgactcggcagtcccaaaaccctccgtctctgacagctcccttgggcatgccctctgcctgctcctgtctcccgtgtggcccagccccggaagctgccatcattctagcgggtcctcccaccgccctcactgtcctgcccaaggggacaggcctcaagaagagcaaacgactgctcctggagtccctcatgcggaggaggattgcacacctgaagtggggtcttccccggcggatcctggagtcctatttcctgtttaacttcttaggatcttgctcattgacccttgctggggcgaggctctctggactgaacacaggccaggagctccaagcccagcaggaaaggtattgtgaggcccaaggctccccaccaggccttaagtccccagagaggttccagagggttcagcgcccagacagaaaaagctcgaaacttcctatacaagccagagctctggagaggaacagaccgcacatgtcagagcccattaagcatttccatccagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: