CTA-216E10.6-hypothetical FLJ23584 Gene View larger

CTA-216E10.6-hypothetical FLJ23584 Gene

PTXBC007210

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTA-216E10.6-hypothetical FLJ23584 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTA-216E10.6-hypothetical FLJ23584 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007210
Product type: DNA & cDNA
Ncbi symbol: CTA-216E10.6
Origin species: Human
Product name: CTA-216E10.6-hypothetical FLJ23584 Gene
Size: 2ug
Accessions: BC007210
Gene id: 79640
Gene description: hypothetical FLJ23584
Synonyms: CTA-216E10.6; uncharacterized protein C22orf46; chromosome 22 open reading frame 46
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcctgtcccccactggggtgaagtcttcctgctggtgggtggggagggagagcatctggccagccagggcacaacccctgccagggatcatagagtggggatcagtccagcctcccagcaggcccaacctgaatcctggagaagacgacaaagggacaaaggggtggatccagagaaggcccccagcctgactcggcagtcccaaaaccctccgtctctgacagctcccttgggcatgccctctgcctgctcctgtctcccgtgtggcccagccccggaagctgccatcattctagcgggtcctcccaccgccctcactgtcctgcccaaggggacaggcctcaagaagagcaaacgactgctcctggagtccctcatgcggaggaggattgcacacctgaagtggggtcttccccggcggatcctggagtcctatttcctgtttaacttcttaggatcttgctcattgacccttgctggggcgaggctctctggactgaacacaggccaggagctccaagcccagcaggaaaggtattgtgaggcccaaggctccccaccaggccttaagtccccagagaggttccagagggttcagcgcccagacagaaaaagctcgaaacttcctatacaagccagagctctggagaggaacagaccgcacatgtcagagcccattaagcatttccatccagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - growth associated protein 43
- canopy 3 homolog (zebrafish)
- Yip1 domain family, member 2
- heme oxygenase (decycling) 2

Buy CTA-216E10.6-hypothetical FLJ23584 Gene now

Add to cart