GAP43-growth associated protein 43 Gene View larger

GAP43-growth associated protein 43 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAP43-growth associated protein 43 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GAP43-growth associated protein 43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007936
Product type: DNA & cDNA
Ncbi symbol: GAP43
Origin species: Human
Product name: GAP43-growth associated protein 43 Gene
Size: 2ug
Accessions: BC007936
Gene id: 2596
Gene description: growth associated protein 43
Synonyms: nerve growth-related peptide GAP43; B-50; PP46; neuromodulin; axonal membrane protein GAP-43; calmodulin-binding protein P-57; neural phosphoprotein B-50; neuron growth-associated protein 43; protein F1; growth associated protein 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtgctgtatgagaagaaccaaacaggttgaaaaaaatgatgacgaccaaaagattgaacaagatggtatcaaaccagaagataaagctcataaggccgcaaccaaaattcaggctagcttccgtggacacataacaaggaaaaagctcaaaggagagaagaaggatgatgtccaagctgctgaggctgaagctaataagaaggatgaagcccctgttgccgatggggtggagaagaagggagaaggcaccactactgccgaagcagccccagccactggctccaagcctgatgagcccggcaaagcaggagaaactccttccgaggagaagaagggggagggtgatgctgccacagagcaggcagccccccaggctcctgcatcctcagaggagaaggccggctcagctgagacagaaagtgccactaaagcttccactgataactcgccgtcctccaaggctgaagatgccccagccaaggaggagcctaaacaagccgatgtgcctgctgctgtcactgctgctgctgccaccacccctgccgcagaggatgctgctgccaaggcaacagcccagcctccaacggagactggggagagcagccaagctgaagagaacatagaagctgtagatgaaaccaaacctaaggaaagtgcccggcaggacgagggtaaagaagaggaacctgaggctgaccaagaacatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - canopy 3 homolog (zebrafish)
- Yip1 domain family, member 2
- heme oxygenase (decycling) 2
- G kinase anchoring protein 1

Buy GAP43-growth associated protein 43 Gene now

Add to cart