FHL3-four and a half LIM domains 3 Gene View larger

FHL3-four and a half LIM domains 3 Gene

PTXBC014501

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FHL3-four and a half LIM domains 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FHL3-four and a half LIM domains 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014501
Product type: DNA & cDNA
Ncbi symbol: FHL3
Origin species: Human
Product name: FHL3-four and a half LIM domains 3 Gene
Size: 2ug
Accessions: BC014501
Gene id: 2275
Gene description: four and a half LIM domains 3
Synonyms: LIM-only protein FHL3; SLIM2; four and a half LIM domains protein 3; FHL-3; SLIM-2; skeletal muscle LIM-protein 2; four and a half LIM domains 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaagacgctgacacagggtggagtgacataccgtgatcagccatggcatcgagaatgtctggtctgtaccggatgccagacgcccctggcagggcagcagttcacctcccgggatgaagatccctactgtgtggcctgttttggagaactctttgcacctaagtgcagcagctgcaagcgccccatcgtaggactcggtggaggcaagtatgtgtcctttgaagaccgacactggcaccacaactgcttctcctgcgcccgctgctctacctccctggtgggccagggcttcgtaccggatggagaccaagtgctctgccagggctgtagccaggcagggccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical FLJ23584
- growth associated protein 43
- canopy 3 homolog (zebrafish)
- Yip1 domain family, member 2

Buy FHL3-four and a half LIM domains 3 Gene now

Add to cart