Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MALL-mal, T-cell differentiation protein-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MALL-mal, T-cell differentiation protein-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003179 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MALL |
| Origin species: | Human |
| Product name: | MALL-mal, T-cell differentiation protein-like Gene |
| Size: | 2ug |
| Accessions: | BC003179 |
| Gene id: | 7851 |
| Gene description: | mal, T-cell differentiation protein-like |
| Synonyms: | BENE; MAL-like protein; mal, T-cell differentiation protein like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcgcccgacccgcccgccaccagctacgccccgtccgacgtgccctcgggggtcgcgctgttcctcaccatccctttcgccttcttcctgcccgagctgatatttgggttcttggtctggaccatggtagccgccacccacatagtataccccttgctgcaaggatgggtgatgtatgtctcgctcacctcgtttctcatctccttgatgttcctgttgtcttacttgtttggattttacaaaagatttgaatcctggagagttctggacagcctgtaccacgggaccactggcatcctgtacatgagcgctgccgtcctacaagtacatgccacgattgtttctgagaaactgctggacccaagaatttactacattaattcggcagcctcgttcttcgccttcatcgccacgctgctctacattctccatgccttcagcatctattaccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - prostaglandin E synthase 3 (cytosolic) - mannose-P-dolichol utilization defect 1 - splicing factor, arginine/serine-rich 5 - inositol(myo)-1(or 4)-monophosphatase 1 |