MPDU1-mannose-P-dolichol utilization defect 1 Gene View larger

MPDU1-mannose-P-dolichol utilization defect 1 Gene

PTXBC001898

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPDU1-mannose-P-dolichol utilization defect 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPDU1-mannose-P-dolichol utilization defect 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001898
Product type: DNA & cDNA
Ncbi symbol: MPDU1
Origin species: Human
Product name: MPDU1-mannose-P-dolichol utilization defect 1 Gene
Size: 2ug
Accessions: BC001898
Gene id: 9526
Gene description: mannose-P-dolichol utilization defect 1
Synonyms: CDGIF; HBEBP2BPA; Lec35; My008; PP3958; PQLC5; SL15; mannose-P-dolichol utilization defect 1 protein; HBeAg-binding protein 2 binding protein A; suppressor of Lec15 and Lec35 glycosylation mutation homolog; mannose-P-dolichol utilization defect 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagctgccccaggtgtttaaaatcctgggagccaagagtgctgaagggttgagtctccagtctgtaatgctggagctagtggcattgactgggaccatggtctacagcatcactaacaacttcccattcagctcttggggtgaagccttattcctgatgctccagacgatcaccatctgcttcctggtcatgcactacagaggacagactgtgaaaggtgtcgctttcctcgcttgctacggcctggtcctgctggtgcttctctcacctctgacgcccttgactgtagtcaccctgctccaggcctccaatgtgcctgctgtggtggtggggaggcttctccaggcagccaccaactaccacaacgggcacacaggccagctctcagccatcacagtcttcctgctgtttgggggctccctggcccgaatcttcacttccattcaggaaaccggagatcccctgatggctgggacctttgtggtctcctctctctgcaacggcctcatcgccacccagctgctcttctactggaatgcaaagcctccccacaagcagaaaaaggcgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - splicing factor, arginine/serine-rich 5
- inositol(myo)-1(or 4)-monophosphatase 1
- SPARC related modular calcium binding 1
- metastasis associated 1 family, member 3

Buy MPDU1-mannose-P-dolichol utilization defect 1 Gene now

Add to cart