PTXBC001898
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001898 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MPDU1 |
| Origin species: | Human |
| Product name: | MPDU1-mannose-P-dolichol utilization defect 1 Gene |
| Size: | 2ug |
| Accessions: | BC001898 |
| Gene id: | 9526 |
| Gene description: | mannose-P-dolichol utilization defect 1 |
| Synonyms: | CDGIF; HBEBP2BPA; Lec35; My008; PP3958; PQLC5; SL15; mannose-P-dolichol utilization defect 1 protein; HBeAg-binding protein 2 binding protein A; suppressor of Lec15 and Lec35 glycosylation mutation homolog; mannose-P-dolichol utilization defect 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagctgccccaggtgtttaaaatcctgggagccaagagtgctgaagggttgagtctccagtctgtaatgctggagctagtggcattgactgggaccatggtctacagcatcactaacaacttcccattcagctcttggggtgaagccttattcctgatgctccagacgatcaccatctgcttcctggtcatgcactacagaggacagactgtgaaaggtgtcgctttcctcgcttgctacggcctggtcctgctggtgcttctctcacctctgacgcccttgactgtagtcaccctgctccaggcctccaatgtgcctgctgtggtggtggggaggcttctccaggcagccaccaactaccacaacgggcacacaggccagctctcagccatcacagtcttcctgctgtttgggggctccctggcccgaatcttcacttccattcaggaaaccggagatcccctgatggctgggacctttgtggtctcctctctctgcaacggcctcatcgccacccagctgctcttctactggaatgcaaagcctccccacaagcagaaaaaggcgcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - splicing factor, arginine/serine-rich 5 - inositol(myo)-1(or 4)-monophosphatase 1 - SPARC related modular calcium binding 1 - metastasis associated 1 family, member 3 |