SFRS5-splicing factor, arginine/serine-rich 5 Gene View larger

SFRS5-splicing factor, arginine/serine-rich 5 Gene

PTXBC018823

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFRS5-splicing factor, arginine/serine-rich 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFRS5-splicing factor, arginine/serine-rich 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018823
Product type: DNA & cDNA
Ncbi symbol: SFRS5
Origin species: Human
Product name: SFRS5-splicing factor, arginine/serine-rich 5 Gene
Size: 2ug
Accessions: BC018823
Gene id: 6430
Gene description: splicing factor, arginine/serine-rich 5
Synonyms: SFRS5; HRS; SRP40; serine/arginine-rich splicing factor 5; SR splicing factor 5; delayed-early protein HRS; pre-mRNA-splicing factor SRP40; splicing factor, arginine/serine-rich 5; serine and arginine rich splicing factor 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtggctgtcgggtattcatcgggagactaaatccagcggccagggagaaggacgtggaaagattcttcaagggatatggacggataagagatattgatctgaaaagaggctttggttttgtggaatttgaggatccaagggatgcagatgatgctgtgtatgagcttgatggaaaagaactctgtagtgaaagggttactattgaacatgctagggctcggtcacgaggtggaagaggtagaggacgatactctgaccgttttagtagtcgcagacctcgaaatgatagacgaaatgctccacctgtaagaacagaaaatcgtcttatagttgagaatttatcctcaagagtcagctggcaggatctcaaagatttcatgagacaagctggggaagtaacgtttgcggatgcacaccgacctaaattaaatgaaggggtggttgagtttgcctcttatggtgacttaaagaatgctattgaaaaactttctggaaaggaaataaatgggagaaaaataaaattaattgaaggcagcaaaaggcacagtaggtcaagaagcaggtctcgatcccggaccagaagttcctctaggtctcgtagccgatcccgttcccgtagtcgcaaatcttacagccggtcaagaagcaggagcaggagccggagccggagcaagtcccgttctgttagtaggtctcccgtgcctgagaagagccagaaacgtggttcttcaagtagatctaagtctccagcatctgtggatcgccagaggtcccggtcccgatcaaggtccagatcagttgacagtggcaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inositol(myo)-1(or 4)-monophosphatase 1
- SPARC related modular calcium binding 1
- metastasis associated 1 family, member 3
- Fanconi anemia, complementation group G

Buy SFRS5-splicing factor, arginine/serine-rich 5 Gene now

Add to cart