Login to display prices
Login to display prices
IMPA1-inositol(myo)-1(or 4)-monophosphatase 1 Gene View larger

IMPA1-inositol(myo)-1(or 4)-monophosphatase 1 Gene

PTXBC008381

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IMPA1-inositol(myo)-1(or 4)-monophosphatase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IMPA1-inositol(myo)-1(or 4)-monophosphatase 1 Gene

Proteogenix catalog: PTXBC008381
Ncbi symbol: IMPA1
Product name: IMPA1-inositol(myo)-1(or 4)-monophosphatase 1 Gene
Size: 2ug
Accessions: BC008381
Gene id: 3612
Gene description: inositol(myo)-1(or 4)-monophosphatase 1
Synonyms: IMP; IMPA; inositol monophosphatase 1; D-galactose 1-phosphate phosphatase; IMP 1; IMPase 1; inositol(myo)-1(or 4)-monophosphatase 1; inositol-1(or 4)-monophosphatase 1; lithium-sensitive myo-inositol monophosphatase A1; myo-inositol monophosphatase 1; testicular tissue protein Li 94
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgatccttggcaggaatgcatggattatgcagtaactctagcaagacaagctggagaggtagtttgtgaagctataaaaaatgaaatgaatgttatgctgaaaagttctccagttgatttggtaactgctacggaccaaaaagttgaaaaaatgcttatctcttccataaaggaaaagtatccatctcacagtttcattggtgaagaatctgtggcagctggggaaaaaagtatcttaaccgacaaccccacatggatcattgaccctattgatggaacaactaactttgtacatagatttccttttgtagctgtttcaattggctttgctgtaaataaaaagatagaatttggagttgtgtacagttgtgtggaaggcaagatgtacactgccagaaaaggaaaaggtgccttttgtaatggtcaaaaactacaagtctcacaacaagaagatattaccaaatctctcttggtgactgagttgggctcttccagaacaccagagactgtgagaatggttctttctaatatggaaaagcttttttgcattcctgttcatgggatccggagtgttggaacagcagctgttaatatgtgccttgtggcaactggcggagcagatgcatattatgaaatgggaattcactgctgggatgttgcaggagctggcattattgttactgaagctggtggcgtgctaatggatgttacaggtggaccatttgatttgatgtcacgaagagtaattgctgcaaataatagaatattagcagaaaggatagctaaagaaattcaggttatacctttgcaacgagacgacgaagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: