Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene
PTXBC003561
New product
Data sheet of AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003561 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP1S1 |
| Origin species: | Human |
| Product name: | AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene |
| Size: | 2ug |
| Accessions: | BC003561 |
| Gene id: | 1174 |
| Gene description: | adaptor-related protein complex 1, sigma 1 subunit |
| Synonyms: | AP19; CLAPS1; EKV3; MEDNIK; SIGMA1A; AP-1 complex subunit sigma-1A; HA1 19 kDa subunit; adapter-related protein complex 1 sigma-1A subunit; adaptor protein complex AP-1 subunit sigma-1A; adaptor-related protein complex 1 subunit sigma-1A; clathrin assembly protein complex 1 sigma-1A small chain; clathrin coat assembly protein AP19; clathrin-associated/assembly/adaptor protein, small 1 (19kD); golgi adaptor HA1/AP1 adaptin sigma-1A subunit; sigma1A subunit of AP-1 clathrin adaptor complex; sigma1A-adaptin; adaptor related protein complex 1 sigma 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgcggttcatgctattattcagccggcagggaaaactgcggctgcaaaaatggtacctggccacttcggacaaggaacggaagaagatggtgcgcgagctcatgcaggttgtcctggctcgaaagcccaagatgtgcagcttcctggagtggagggacctcaaagttgtctataagagatatgccagcctctacttctgctgcgccatcgagggccaagacaatgagctcatcacactggagctgatccaccgatacgtggagctcttagacaaatactttggcagtgtgtgcgagctggacatcatcttcaactttgagaaggcctacttcatcctggatgagtttttgatggggggggatgtccaggacacctccactttccccttttcccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 8 family, member D - adaptor-related protein complex 1, sigma 2 subunit - adaptor-related protein complex 3, sigma 2 subunit - origin recognition complex, subunit 4-like (yeast) |