Login to display prices
Login to display prices
AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene View larger

AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene

PTXBC003561

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene

Proteogenix catalog: PTXBC003561
Ncbi symbol: AP1S1
Product name: AP1S1-adaptor-related protein complex 1, sigma 1 subunit Gene
Size: 2ug
Accessions: BC003561
Gene id: 1174
Gene description: adaptor-related protein complex 1, sigma 1 subunit
Synonyms: AP19; CLAPS1; EKV3; MEDNIK; SIGMA1A; AP-1 complex subunit sigma-1A; HA1 19 kDa subunit; adapter-related protein complex 1 sigma-1A subunit; adaptor protein complex AP-1 subunit sigma-1A; adaptor-related protein complex 1 subunit sigma-1A; clathrin assembly protein complex 1 sigma-1A small chain; clathrin coat assembly protein AP19; clathrin-associated/assembly/adaptor protein, small 1 (19kD); golgi adaptor HA1/AP1 adaptin sigma-1A subunit; sigma1A subunit of AP-1 clathrin adaptor complex; sigma1A-adaptin; adaptor related protein complex 1 sigma 1 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgcggttcatgctattattcagccggcagggaaaactgcggctgcaaaaatggtacctggccacttcggacaaggaacggaagaagatggtgcgcgagctcatgcaggttgtcctggctcgaaagcccaagatgtgcagcttcctggagtggagggacctcaaagttgtctataagagatatgccagcctctacttctgctgcgccatcgagggccaagacaatgagctcatcacactggagctgatccaccgatacgtggagctcttagacaaatactttggcagtgtgtgcgagctggacatcatcttcaactttgagaaggcctacttcatcctggatgagtttttgatggggggggatgtccaggacacctccactttccccttttcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: