SPIRE1-spire homolog 1 (Drosophila) Gene View larger

SPIRE1-spire homolog 1 (Drosophila) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPIRE1-spire homolog 1 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPIRE1-spire homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016825
Product type: DNA & cDNA
Ncbi symbol: SPIRE1
Origin species: Human
Product name: SPIRE1-spire homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC016825
Gene id: 56907
Gene description: spire homolog 1 (Drosophila)
Synonyms: Spir-1; protein spire homolog 1; spire actin nucleation factor 1; spire family actin nucleation factor 1; spire homolog 1; spire type actin nucleation factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctgccctccaaaccatactccactcttcctatcttttcattgggaccttctgctctgcaaagaggggaaagtagtatgaggtcagaaaaaccctccactgcccatcatcggccacttcggagcattgccaggttctcctcaaaatctaagtctatggacaaatcagatgaagaactccagtttcccaaagagttgatggaggactggagcaccatggaggtgtgtgtggactgcaagaagttcatttcggaaatcatcagttcaagccggcgcagtctggtgttggccaacaaaagggcccgattgaaaaggaaaacgcagtctttctacatgtcctcgccaggcccctcggagtactgcccttcagagaggacgatcagtgagatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LY6/PLAUR domain containing 1
- ISG15 ubiquitin-like modifier
- ADP-ribosylation factor-like 2
- armadillo repeat containing 7

Buy SPIRE1-spire homolog 1 (Drosophila) Gene now

Add to cart